The Epstein-Barr Virus Promoter Initiating B-Cell Transformation Is Activated by RFX Proteins and the B-Cell-Specific Activator Protein BSAP/Pax5

Cell lines.

A number of human B-cell and non-B-cell lines were used for the preparation of nuclear extracts and for transient transfection assays. Established B-cell lines were the EBV-negative Burkitt's lymphoma-derived cell lines DG75 and Ramos, the EBV-positive Burkitt's lymphoma-derived cell line Akata, and the EBV-transformed lymphoblastoid cell line IB4. The non-B cells included the T-cell leukemic lines CEM and Jurkat, the proerythroleukemic line K562, and the simian virus 40-transformed epidermal keratinocyte line Rhek. All cells with the exception of Rhek were maintained as suspension cultures in RPMI 1640 supplemented with 10% (vol/vol) selected fetal calf serum, 2 mM glutamine, and 100 mg of gentamicin per liter. Rhek cells were grown in Joklik's medium supplemented with 8% (vol/vol) fetal calf serum, 2 mM glutamine, and 0.4 μg of hydrocortisone per ml.

Plasmid constructs.

The Wp440/GL2 reporter plasmid, in which the luciferase reporter gene is under the control of Wp sequence positions −440 to +175 (relative to the Wp RNA start site), has been described previously (6). The site B, site C, and site D mutant reporter constructs were made using appropriate oligonucleotides and the Sculptor mutagenesis system (Amersham Pharmacia). The BSAP expression vector containing the human BSAP cDNA cloned into pSG5 (44) was kindly provided by Andreas Reimold (Harvard Medical School, Boston, Mass.).

Bandshift assays.

The preparation of nuclear extracts and the in vitro binding assays have been described previously (6); binding reactions were carried out with either poly(dI-dC) (Amersham Pharmacia) or sheared herring sperm DNA (Sigma) to reduce complex formation due to nonspecific DNA binding proteins. In the initial bandshift assays, long probes carrying Wp sequence positions −352 to −264, −264 to −135, and −135 to −70 were generated by digestion of Wp440/GL2 Basic with SacI/AvrII, AvrII/ApaI, and ApaI/MunI, respectively. Two additional overlapping probes, −316/−135 and −170/−70, were generated by SacI/ApaI digestion of a truncated Wp reporter plasmid Wp316/GL2 Basic produced as one of a series of promoter truncations in earlier work (6) and by NcoI/MunI digestion of a Wp440 derivative in which an NcoI site had been introduced at −173 to −168 by site-directed mutagenesis, respectively. The appropriate fragments were then dephosphorylated using alkaline phosphatase and gel purified before labeling with [γ-³²P]ATP and polynucleotide kinase. The short double-stranded oligonucleotide competitors (Alta Biosciences, University of Birmingham) used for Fig. 2 were MIF-1 (GATCTAGAGTAGTTATGGTAACTGGG), MIF-1 m (GATCTAGAGTAGTTATGATTACTGGG), HBV enh-I (GATCCGTTGCTCGGCAACGGCCTA), HBV enh-I m (GATCCCAACCTCGGCAACGGCCTA), and HLA DRA X (GATCCCCTTCCCCTAGCAACAGATGA) (mutations are underlined); designations are explained in Results).

To determine the minimal sequence required for factor binding to site D within the −264/−135 probe, a number of truncated double-stranded oligonucleotide competitors carrying Wp sequences −254/−215, −254/−220, −242/−215, −242/−220, −237/−215, and −232/−215 were synthesized. Competitor oligonucleotides and/or probes containing the wild-type and mutant YY1 sites (Wp −308/−279 and mut YY1), the CREB site (Wp −102/−77), and sites B (Wp −115/−86) and C (Wp −140/−99) have been described previously (6); in some cases the site C competitor sequence and its mutant derivatives were shortened to nucleotides −125 to −99. Competitor oligonucleotides (1,000-fold excess unless stated otherwise) were added to the binding reaction prior to addition of the radiolabeled probe. The following antibodies, purchased as TransCruz Gel Supershift reagents (Santa Cruz Biotechnology), were also included in the relevant binding reactions: a rabbit polyclonal antibody against YY1 (C-20), a mouse monoclonal antibody against CREB proteins (25C 10G), a rabbit polyclonal antibody against Oct1 (C-21), and a goat polyclonal antibody against BSAP (C-20). Antisera against RFX1, RFX3, and RFX5 were kindly provided by Walter Reith (University of Geneva, Geneva, Switzerland), and the MIBP1 antiserum was kindly provided by Maria Zajac-Kaye (Naval Oncology Center, National Institutes of Health, Bethesda, Md.). In vitro-translated (IVT) YY1 and BSAP were generated using the T7 TNT coupled reticulocyte lysate system (Promega) according to the manufacturer's instructions.

Transient transfection and reporter assays.

Cell cultures were transiently transfected with 8 μg of luciferase reporter containing the relevant Wp sequences and 2 μg of a constitutively expressed β-galactosidase reporter (CMV-βgal) as previously described (6). Wp reporter activities were measured by quantifying luciferase expression in whole-cell extracts at 16 to 24 h posttransfection; the luciferase activity in each sample was then normalized for variations in transfection efficiency by measuring the level of β-galactosidase expression from the cotransfected CMV-βgal plasmid. In the case of the BSAP transactivation experiments, 2 μg of BSAP/pSG5 or 2 μg of empty pSG5 vector was included with the appropriate luciferase reporter constructs and CMV-βgal as above.

Binding of lineage-independent and B-cell-specific factors to Wp sequences.

Figure 1a shows a schematic representation of Wp in its genomic context, downstream of oriP and Cp, and identifies the main lineage-independent regulatory region UAS2 with its constituent YY1 site and the B-cell-specific region UAS1 with its constituent CREB/ATF site. The additional sites (B, C, and D) within UAS1 were either known from earlier work (6) or identified in the present study. Since our previous analysis of factor binding to Wp had used short oligonucleotide probes representing only a few selected sequences within the promoter, we first carried out a more systematic screening using a series of longer radiolabeled probes designed to cover the entire −352 to −70 region.

Focusing first on UAS2, Fig. 1b shows the protein-DNA complexes formed when the −352/−264 probe was incubated with nuclear extracts prepared from B-cell lines (Akata, Ramos, DG75, and IB4) or from non-B-cell lines of epithelial (Rhek), T-cell (CEM and Jurkat), and erythroleukemic cell (K562) origin. In all cases, we detected the same two complexes, implying that this lineage-independent region of Wp interacts only with ubiquitously expressed factors. The data in Fig. 1b strengthen our earlier conclusion that the cellular factor YY1 is the major determinant of UAS2 activity. Thus, the formation of both complexes could be inhibited by the addition of a short oligonucleotide competitor representing the minimal YY1 binding sequence from −308 to −279 (Fig. 1b, lane 9) but not by mut YY1, a sequence that had lost YY1 binding activity (lane 10); furthermore, both complexes were supershifted by a YY1-specific polyclonal antibody (data not shown). Since incubation of the probe with IVT YY1 reproduced only the faster-migrating of the two complexes (data not shown), we infer that this faster-migrating complex contains YY1 alone whereas the second complex contains YY1 and an additional cellular factor.

We then monitored complex formation using a second large probe, Wp −135/−70, spanning a region previously shown to encompass a CREB binding site and two adjacent sites, B and C. Note that here, as in all experiments with long probes, we screened for factor binding under two different reaction conditions since we had previously noted that complex formation at certain sites in Wp was differentially affected by the choice of nonspecific DNA competitor. Under the first set of conditions (Fig. 1e), we showed that the only detectable complexes could be specifically competed out using a small oligonucleotide representing the minimal CREB site sequence (lane 8) but not by competitors representing site B or C (lane 9 or 10). The identity of these ubiquitously expressed proteins as members of the CREB/ATF family was confirmed by supershift experiments using a CREB/ATF antibody (data not shown). Parallel experiments in which the Wp −135/−70 probe was incubated under alternative binding conditions (Fig. 1d) revealed a number of slow-migrating complexes which were detected using nuclear extracts of both B-cell and non-B-cell lines; these complexes appeared identical to those previously obtained using a short site C oligonucleotide probe (6), since their formation was specifically inhibited by the addition of a site C competitor but not site B or CREB site sequences. More importantly, a faster-migrating complex was detected exclusively in the presence of B-cell extracts. We found that this complex reflected factor binding to site B within the large Wp −135/−70 probe, since a short oligonucleotide competitor representing site B specifically blocked the interaction.

A further set of bandshift assays used a long probe, Wp −264/−135 (Fig. 1c), spanning a region not analyzed in detail in earlier work. Interestingly, this revealed the presence of a single protein-DNA complex which, like that at site B, was observed only with B-cell extracts. We therefore took this as evidence for the existence of a new binding site, site D, within the −264 to −135 region; the precise location of site D was determined subsequently (see below). To eliminate the possibility of additional binding sites located in the junction regions between the long probes used above, we also generated two further fragments carrying Wp sequences which spanned these junctions. However, bandshift assays using these two new probes, Wp −316/−135 and Wp −170/−70, did not detect any additional complexes (data not shown). Furthermore, while the results shown in Fig. 1b to e were obtained using nuclear extracts from established B-cell lines, we also observed the same DNA binding factors in nuclear extracts prepared from freshly isolated primary B lymphocytes (the natural target cells for EBV infection), and levels of these factors were not altered following virus binding and in vitro infection (data not shown). Taken together, these findings suggest that YY1, CREB/ATF, and the unidentified factors binding sites B, C, and D represent the full complement of B-cell transcription factors associated with Wp sequence from −352 to −70.

Identification of RFX proteins binding to site C.

Focusing first on site C (−140 to −99), we searched the TRANSFAC database to identify potential cellular factors that might bind to this sequence. As shown in Fig. 2A, this revealed a significant homology between nucleotides −122 to −110 and the consensus binding motif for the RFX family of transcriptional regulators (14). Of these, RFX1, RFX2, and RFX3 have been implicated in the regulation of viral and cellular genes and shown to bind target sites as both homodimers and heterodimers (22, 31, 45, 46, 48, 50, 51), while RFX5 specifically associates with the promoters of HLA class II genes as a complex with two other proteins, RFX-AP and RFX-ANK/RFX-B (12, 34, 37, 55). In addition, another cellular factor, MIBP1 (myc intron binding factor 1), first identified as a regulator of c-myc gene expression (65), has been implicated in the regulation of RFX-dependent promoters (45) and can form heterodimers with at least one member of the RFX family, RFX1 (7).

To investigate if site C can interact with these RFX factors, a radiolabeled site C oligonucleotide probe was incubated with nuclear extract in the presence of unlabeled competitor sequences containing known RFX/MIBP1 binding sites. These competitors, shown in Fig. 2A, are derived from the RFX binding sequences at the hepatitis B virus enhancer I (HBV enh-I), the MIBP1 binding site from the first intron of the human myc promoter (MIF-1), and the X box sequence from the human HLA class II DRA promoter (HLA DRA X). The results in Fig. 2B demonstrate that the formation of site C complexes in the presence of both DG75 (B-cell) and Jurkat (T-cell) nuclear extracts was inhibited by the addition of the HBV enh-I, MIF-1, and HLA DRA X competitor oligonucleotides, as well as by addition of a site C competitor itself. In contrast, the mutant sequences HBV enh-I m and MIF-1 m, previously reported to have lost RFX/MIBP1 binding (45), and the mutant site C sequence m1 (6) were unable to compete. These findings provide the first evidence that site C is indeed a functional RFX binding site.

We next used specific antisera raised against individual RFX proteins to identify which of these factors was binding site C in our in vitro assays. The results in Fig. 2C show that the largest complex, c′, was shifted in the presence of a MIBP1 antibody and its formation was blocked by an RFX1 antibody. A second complex, c", was blocked by antibodies against RFX1 and RFX3, while a third complex, c‴, though weaker, appeared to be blocked by an antibody against RFX3. In contrast, there were no detectable differences in complex formation or mobility in the presence of an RFX5 antibody or a control Oct-1 antibody. These findings indicate that RFX1, RFX3, and MIBP1 present in DG75 nuclear extracts can interact with the site C sequence in a combination of homodimeric and heterodimeric complexes. Similar results were obtained using Jurkat nuclear extracts, consistent with previous reports that these RFX factors are ubiquitously expressed (46).

Effect of mutations in site C on RFX binding and Wp activity.

Although the RFX consensus binding motif contains a palindromic sequence, it has been reported that in certain cases RFX proteins can bind as monomers rather than dimers and that one half of the binding motif may be sufficient for the interaction (8, 10). We therefore investigated the sequence requirements for RFX complex formation at Wp by introducing a series of base substitutions throughout site C and then using each of these mutant sequences (m1 to m4 [Fig. 3A]) as competitor in a bandshift assay. The results in Fig. 3B show that m1 and m2 were unable to compete for factor binding, m3 led to a partial reduction in binding, while m4 competed as effectively as the wild-type sequence. This suggested that Wp sequences in the half-site between −125 and −116 were the more important for RFX binding. To further investigate if binding to site C requires one or both half-sites, we synthesized two additional competitors carrying truncated site C sequences: LH, which contains the 5′ half-site sequence (−125 to −113); and RH, which contains the 3′ sequence (−119 to −107). The results in Fig. 3C show that the LH, but not the RH, sequence was sufficient to compete for RFX binding to site C. This result is consistent with the bandshift data in Fig. 3B and also accounts for our earlier observation that the minimum sequences for site C binding are located between −125 and −111 (6).

We then investigated the effects of m1 to m4 on Wp activity in a transient assay system using the Wp440 reporter construct that includes both the UAS1 and UAS2 regions (Fig. 3D). In the case of the B-cell line DG75, introduction of mutations m1 and m2, which blocked RFX binding in vitro, decreased Wp activity seven- to ninefold. In contrast, the m3 and m4 changes had little if any effect both on RFX binding and on promoter function. As a control, we repeated this experiment using the non-B-cell line K562, in which the B-cell-specific UAS1 region of Wp is not operational. In this case, Wp activity was much lower but was not affected significantly by any of the site C mutations. Taken together with the results of the bandshift studies, these findings strongly imply that RFX proteins are involved in B-cell-specific activation of Wp.

Site B and site D are binding sites for the same B-cell-specific cellular protein.

We then analyzed the two sites within UAS1 which bound B-cell-specific factors in the initial bandshift studies: site B (already identified as −115 to −86) and the newly identified site D, which lay within the Wp −264/−135 probe used in the first experiments (Fig. 1c). Further bandshift studies were carried out using this latter probe and a series of shorter oligonucleotide competitors. As shown in Fig. 4A, this localized site D to the −242 to −215 region, that being the shortest sequence capable of fully competing out binding of the B-cell-specific factor.

Although there was no immediate homology apparent between the site D and site B sequences, we carried out a series of cross-competition assays to examine whether the two sites were binding the same or different B-cell-specific proteins. These assays included as competitors the wild-type site D and site B sequences and derived mutant sequences known to have lost binding activity (reference 6 and data not shown). The results in Fig. 4C (top gel) show that formation of the site D-specific complex was inhibited in a concentration-dependent manner both by site D and site B competitors, while the relevant mutant sequences did not compete. The corresponding experiment looking at binding to a site B probe (Fig. 4C, bottom gel) likewise showed concentration-dependent competition by both site D and site B competitors but not by the mutant oligonucleotides. In both assays, at low concentrations the site D sequence was a more effective competitor than the site B sequence. These findings strongly imply that the same B-cell-specific protein was binding to both sites, though with higher affinity to the site D sequence.

Identification of sites B and D as binding sites for B-cell-specific activator protein BSAP/Pax-5.

Searching databases of known transcription factor binding motifs revealed a limited homology between the site D sequence and a consensus motif (9) for the B-cell-specific transcription factor BSAP/Pax5 (Fig. 5A). There was also a lesser degree of sequence homology between this BSAP consensus and site B, although this would not have been considered significant had we not already known that sites B and D bound the same protein. BSAP, a mammalian homologue of the sea urchin tissue-specific activator protein (4), was originally identified by its ability to interact with conserved regulatory sequences upstream of late histone genes (5). We therefore carried out bandshift assays to determine if these site B and site D sequences could compete for BSAP binding to the sea urchin histone promoter-derived oligonucleotide probe H2B 2.1 (4). The results in Fig. 5B (top) show that the H2B 2.1 probe formed a specific complex in the presence of nuclear extract prepared from the B-cell lines Ramos and DG75, but not in extracts from the T-cell lines CEM and Jurkat, consistent with the B-cell-restricted expression of BSAP (5). Moreover, formation of this complex was abrogated by either site B or site D competitor, implying that the same B-cell-restricted factor interacted with all three sites. This was confirmed in parallel experiments, in which incubation of B-cell nuclear extract with a site D (Fig. 5B, middle) or site B (Fig. 5B, bottom) probe gave rise to a complex with electrophoretic mobility similar to that of the complex formed in the presence of the H2B 2.1 probe. Supershift assays further confirmed that the complexes formed by all three probes contained BSAP; thus, addition of a BSAP-specific polyclonal antibody led to the inhibition of complex formation in all three cases, whereas a control YY1-specific antibody had no effect. Finally, we demonstrated that IVT BSAP formed a single complex with the H2B 2.1, site D, and site B probes, which in each case comigrated with that formed in the presence of B-cell nuclear extract. As expected, these complexes with IVT protein were abrogated by the addition of either site B or site D competitor or an anti-BSAP antibody, confirming that the B-cell-specific factor which binds to these Wp sites is BSAP.

Effect of BSAP binding on Wp activity.

Having demonstrated that BSAP binds to two sites in Wp, we next determined the contribution of these sites to Wp activity in different B and non-B-cell lines. The Bm (site B) and Dm1 and Dm2 (site D) mutations, known to abrogate BSAP binding in vitro (Fig. 5), were introduced either singly or in combination into the Wp440 luciferase reporter. The activities of the wild-type and mutant promoter constructs were then compared in transient transfection assays (Fig. 6A). In the three B-cell lines tested (Akata, Ramos, and DG75), mutation of either site B or site D led to a three- to fourfold drop in luciferase expression compared to cells transfected with the wild-type Wp 440 reporter. However, there was an even greater reduction of 5- to 10-fold when both BSAP binding sites were mutated. By contrast, when the experiments were repeated in the non-B-cell lines K562 (Fig. 6A) and CEM (data not shown), mutation of either one or both BSAP binding sites had no significant effect on the low basal levels of promoter activity.

While the above results strongly suggested that BSAP binding to sites B and D is critical for optimal Wp activity in B-cell lines, we sought independent evidence that BSAP could directly activate Wp. Figure 6B shows the results of experiments in which a BSAP expression vector BSAP/SG5 (or the empty vector pSG5 as a control) was cotransfected with a reporter construct containing Wp sequences with either wild-type or mutated BSAP sites. In the B-cell lines DG75 (already BSAP positive), cotransfection of the wild-type Wp440 reporter and BSAP/SG5 resulted in an approximately twofold increase in promoter activity relative to that seen in cells cotransfected with Wp440 and the empty pSG5 control. This appears to reflect a weak promiscuous reporter activation by BSAP in transient assays because similar increases were also seen with Wp reporters carrying mutated site B and site D sequences and even with a truncated Wp reporter, Wp87, that lacks both UAS1 and UAS2 regulatory sequences. A second B-cell line, Akata, gave similar results (data not shown). By contrast, introduction of a BSAP expression vector into the non-B-cell line K562 led to a 33-fold increase in wild-type Wp440 activity; this was reduced to approximately 10-fold for reporters in which one of the BSAP binding sites was inactivated and was further reduced to 6-fold for reporters lacking both binding sites (Fig. 6B). Note that this residual BSAP-mediated activation again appeared to be promiscuous since it was observed even with the minimal Wp87 reporter construct. Parallel experiments in a second non-B-cell line, CEM, showed a similar specific enhancement of Wp activity that was dependent on the presence of the BSAP binding sites B and D (data not shown).

• 1.Adams B, Dörfler P, Aguzzi A, Kozmik Z, Urbánek P, Maurer-Fogy I, Busslinger M. Pax-5 encodes the transcription factor BSAP and is expressed in B lymphocytes, the developing CNS, and adult testis. Genes Dev. 1992;6:1589–1607. doi: 10.1101/gad.6.9.1589. [DOI] [PubMed] [Google Scholar]
• 2.Alfieri C, Birkenbach M, Kieff E. Early events in Epstein-Barr virus infection of human B lymphocytes. Virology. 1991;181:595–608. doi: 10.1016/0042-6822(91)90893-g. [DOI] [PubMed] [Google Scholar]
• 3.Babcock G J, Decker L L, Volk M, Thorley-Lawson D A. EBV persistence in memory B cells in vivo. Immunity. 1998;9:395–404. doi: 10.1016/s1074-7613(00)80622-6. [DOI] [PubMed] [Google Scholar]
• 4.Barberis A, Superti-Furga G, Vitelli L, Kemlar I, Busslinger M. Developmental and tissue-specific regulation of a novel transcription factor of the sea urchin. Genes Dev. 1989;3:663–675. doi: 10.1101/gad.3.5.663. [DOI] [PubMed] [Google Scholar]
• 5.Barberis A, Widenhorn K, Vitelli L, Busslinger M. A novel B-cell lineage-specific transcription factor present at early but not late stages of differentiation. Genes Dev. 1990;4:849–859. doi: 10.1101/gad.4.5.849. [DOI] [PubMed] [Google Scholar]
• 6.Bell A, Skinner J, Kirby H, Rickinson A. Characterisation of regulatory sequences at the Epstein-Barr virus BamHI W promoter. Virology. 1998;252:149–161. doi: 10.1006/viro.1998.9440. [DOI] [PubMed] [Google Scholar]
• 7.Blake M, Niklinski J, Zajac-Kaye M. Interactions of the transcription factors MIBP1 and RFX1 with the EP element of the hepatitis B virus enhancer. J Virol. 1996;70:6060–6066. doi: 10.1128/jvi.70.9.6060-6066.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 8.Cornille F, Emery P, Schüler W, Lenoir C, Mach B, Roques B P, Reith W. DNA binding properties of a chemically synthesized DNA binding domain of hRFX1. Nucleic Acids Res. 1998;26:2143–2149. doi: 10.1093/nar/26.9.2143. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 9.Czerny T, Schaffner G, Busslinger M. DNA sequence recognition by Pax proteins: bipartite structure of the paired domain and its binding site. Genes Dev. 1993;7:2048–2061. doi: 10.1101/gad.7.10.2048. [DOI] [PubMed] [Google Scholar]
• 10.David E, Garcia A D, Hearing P. Interaction of EF-C/RFX1 with the inverted repeat of viral enhancer regions is required for transactivation. J Biol Chem. 1995;270:8353–8360. doi: 10.1074/jbc.270.14.8353. [DOI] [PubMed] [Google Scholar]
• 11.Dörfler P, Busslinger M. C-terminal activating and inhibitory domains determine the transactivation potential of BSAP (Pax-5), Pax-2 and Pax-8. EMBO J. 1996;15:1971–1982. [PMC free article] [PubMed] [Google Scholar]
• 12.Durand B, Sperisen P, Emery P, Barras E, Zuffery M, Mach B, Reith W. RFXAP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. EMBO J. 1997;16:1045–1055. doi: 10.1093/emboj/16.5.1045. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 13.Emery P, Durand B, Mach B, Reith W. RFX proteins, a novel family of DNA binding proteins conserved in the eukaryotic kingdom. Nucleic Acids Res. 1996;24:803–807. doi: 10.1093/nar/24.5.803. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 14.Emery P, Strubin M, Hofmann K, Bucher P, Mach B, Reith W. A consensus motif in the RFX DNA binding domain and binding domain mutants with altered specificity. Mol Cell Biol. 1996;16:4486–4494. doi: 10.1128/mcb.16.8.4486. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 15.Fahraeus R, Jansson A, Ricksten A, Sjoblom A, Rymo L. Epstein-Barr virus-encoded nuclear antigen 2 activates the viral latent membrane protein by modulating the activity of a negative regulatory element. Proc Natl Acad Sci USA. 1990;87:7390–7394. doi: 10.1073/pnas.87.19.7390. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 16.Fearon D T, Carter R H. The CD19/CR2/TAPA-1 complex of B lymphocytes-linking natural to acquired-immunity. Annu Rev Immunol. 1995;13:127–149. doi: 10.1146/annurev.iy.13.040195.001015. [DOI] [PubMed] [Google Scholar]
• 17.Gajiwala K S, Chen H, Cornille F, Roques B P, Reith W, Mach B, Burley S K. Structure of the winged-helix protein hRFX1 reveals a new mode of DNA binding. Nature. 2000;403:916–921. doi: 10.1038/35002634. [DOI] [PubMed] [Google Scholar]
• 18.Garcia A D, Ostapachuk P, Hearing P. Functional interaction of nuclear factors EF-C, HNF-4, and RXR alpha with hepatitis B virus enhancer I. J Virol. 1993;67:3940–3950. doi: 10.1128/jvi.67.7.3940-3950.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 19.Grossman S R, Johannsen E, Tong X, Yalamanchilli R, Kieff E. The Epstein-Barr virus nuclear antigen 2 transactivator is directed to response elements by the J kappa recombination signal binding protein. Proc Natl Acad Sci USA. 1994;91:7568–7572. doi: 10.1073/pnas.91.16.7568. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 20.Guo W T, Bell K D, Ou J H. Characterization of the hepatitis B virus EnhI enhancer and X promoter complex. J Virol. 1991;65:6686–6692. doi: 10.1128/jvi.65.12.6686-6692.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 21.Henkel T, Ling P D, Hayward S D, Peterson M G. Mediation of Epstein-Barr virus EBNA2 transactivation by recombination signal-binding protein Jκ. Science. 1994;265:92–95. doi: 10.1126/science.8016657. [DOI] [PubMed] [Google Scholar]
• 22.Iwama A, Pan J, Reith W, Mach B, Tenen D G, Sun Z. Dimeric RFX proteins contribute to the activity and lineage specificity of the interleukin-5 receptor α promoter through activation and repression domains. Mol Cell Biol. 1999;19:3940–3950. doi: 10.1128/mcb.19.6.3940. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 23.Jansson A, Masucci M, Rymo L. Methylation of discrete sites within the enhancer region regulates the activity of the Epstein-Barr virus BamHI W promoter in Burkitt lymphoma cell lines. J Virol. 1992;66:62–69. doi: 10.1128/jvi.66.1.62-69.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 24.Jin X W, Speck S H. Identification of critical cis elements involved in mediating Epstein-Barr virus nuclear antigen 2-dependent activity of an enhancer located upstream of the viral BamHI C promoter. J Virol. 1992;66:2846–2852. doi: 10.1128/jvi.66.5.2846-2852.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 25.Jones K, Rivera C, Sgadari C, Franklin J, Max E, Bhatia K, Tosata G. Infection of human endothelial cells with Epstein-Barr virus. J Exp Med. 1995;173:971–980. doi: 10.1084/jem.182.5.1213. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 26.Kieff E. Epstein-Barr virus and its replication. In: Fields B N, Knipe D M, Howley P M, editors. Fields virology. Philadelphia, Pa: Lippincott-Raven Press; 1996. pp. 2343–2396. [Google Scholar]
• 27.Kirby H, Rickinson A, Bell A. The activity of the Epstein-Barr virus BamHI W promoter in B cells is dependent on the binding of CREB/ATF factors. J Gen Virol. 2000;81:1057–1066. doi: 10.1099/0022-1317-81-4-1057. [DOI] [PubMed] [Google Scholar]
• 28.Knox P G, Li Q X, Rickinson A B, Young L S. In vitro production of stable Epstein-Barr virus positive epithelial cell clones which resemble the virus-cell interaction observed in nasopharyngeal carcinoma. Virology. 1996;215:40–50. doi: 10.1006/viro.1996.0005. [DOI] [PubMed] [Google Scholar]
• 29.Knutson J C. The level of c-fgr RNA is increased by EBNA-2, an Epstein-Barr virus gene required for B-cell immortalization. J Virol. 1990;64:2530–2536. doi: 10.1128/jvi.64.6.2530-2536.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 30.Li Q X, Young L S, Niedobitek G, Dawson C W, Birkenbach M, Wang F, Rickinson A B. Epstein-Barr virus infection and replication in a human epithelial cell system. Nature. 1992;356:347–350. doi: 10.1038/356347a0. [DOI] [PubMed] [Google Scholar]
• 31.Lui M S, Lee B H, Matthews M B. Involvement of RFX1 protein in the regulation of the human proliferating cell nuclear antigen promoter. J Biol Chem. 1999;274:15433–15439. doi: 10.1074/jbc.274.22.15433. [DOI] [PubMed] [Google Scholar]
• 32.Mach B, Steimle V, Martinez-Soria E, Reith W. Regulation of MHC class II genes: lessons from a disease. Annu Rev Immunol. 1996;14:301–331. doi: 10.1146/annurev.immunol.14.1.301. [DOI] [PubMed] [Google Scholar]
• 33.Masucci M G, Contreras-Salazar B, Ragnar E, Falk K, Minarovits J, Ernberg I, Klein G. 5-Azacytidine up regulates the expression of Epstein-Barr virus nuclear antigen 2 (EBNA-2) through EBNA-6 and latent membrane protein in the Burkitt's lymphoma line Rael. J Virol. 1989;63:3135–3141. doi: 10.1128/jvi.63.7.3135-3141.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 34.Masternak K, Barras E, Zufferey E, Conrad B, Corthals G, Aebersold R, Sanchez J-C, Hochstrasser D F, Mach B, Reith W. A gene encoding a novel RFX-associated transactivator is mutated in the majority of MHC class II deficiency patients. Nat Genet. 1998;20:273–277. doi: 10.1038/3081. [DOI] [PubMed] [Google Scholar]
• 35.Miyashita E M, Yang B, Babcock G J, Thorley-Lawson D A. Identification of the site of Epstein-Barr virus persistence in vivo as a resting B cell. J Virol. 1997;71:4882–4891. doi: 10.1128/jvi.71.7.4882-4891.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 36.Moreno C, Beresford G W, Louis-Plence P, Morris A C, Boss J M. CREB regulates MHC class II expression in a CIITA-dependent manner. Immunity. 1999;10:143–151. doi: 10.1016/s1074-7613(00)80015-1. [DOI] [PubMed] [Google Scholar]
• 37.Nagarajan U M, Louis-Plence P, DeSandro A, Nilsen R, Bushey A, Boss J M. RFX-B is the gene responsible for the most common cause of the bare lymphocyte syndrome, an MHC class II immunodeficiency. Immunity. 1999;10:153–162. doi: 10.1016/s1074-7613(00)80016-3. [DOI] [PubMed] [Google Scholar]
• 38.Nemerow G, Mold C, Schwend V, Tollefson V, Cooper N. Identification of gp350 as the viral glycoprotein mediating attachment of Epstein-Barr virus (EBV) to the EBV/C3d receptor of B cells: sequence homology of gp350 and C3 complement fragment. J Virol. 1987;61:1416–1420. doi: 10.1128/jvi.61.5.1416-1420.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 39.Nishikawa J, Imai S, Oda T, Kojima T, Okita K, Takada K. Epstein-Barr virus promotes epithelial cell growth in the absence of EBNA2 and LMP1 expression. J Virol. 1999;73:1286–1292. doi: 10.1128/jvi.73.2.1286-1292.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 40.Nutt S L, Urbánek P, Rolink A, Busslinger M. Essential functions of Pax5 (BSAP) in pro-B cell development: difference between fetal and adult B lymphopoiesis and reduced V-to-DJ recombination at the IgH locus. Genes Dev. 1997;11:476–491. doi: 10.1101/gad.11.4.476. [DOI] [PubMed] [Google Scholar]
• 41.Nutt S L, Heavey B, Rolink A G, Busslinger M. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature. 1999;401:556–562. doi: 10.1038/44076. [DOI] [PubMed] [Google Scholar]
• 42.Puglielli M T, Woisetschlaeger M, Speck S H. oriP is essential for EBNA gene promoter activity in Epstein-Barr virus-immortalized lymphoblastoid cell lines. J Virol. 1996;70:5758–5768. doi: 10.1128/jvi.70.9.5758-5768.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 43.Qu L, Rowe D T. Epstein-Barr virus latent gene expression in uncultured peripheral blood lymphocytes. J Virol. 1992;66:3715–3724. doi: 10.1128/jvi.66.6.3715-3724.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 44.Reimold A M, Ponath P D, Li Y-S, Hardy R R, David C S, Strominger J L, Glimcher L H. Transcription factor B cell lineage-specific protein regulates the gene for the human X-box binding protein 1. J Exp Med. 1996;183:393–401. doi: 10.1084/jem.183.2.393. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 45.Reinhold W, Emens L, Itkes A, Blake M, Ichinose I, Zajac-Kaye M. The myc intron-binding polypeptide associates with RFX1 in vivo and binds to the major histocompatibility complex class II promoter region, to the hepatitis B virus enhancer, and to regulatory regions of several distinct viral genes. Mol Cell Biol. 1995;15:3041–3048. doi: 10.1128/mcb.15.6.3041. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 46.Reith W, Ucla C, Barras E, Gaud A, Durand B, Herrero-Sanchez C, Kobr M, Mach B. RFX1, a transactivator of hepatitis B virus enhancer I, belongs to a novel family of homodimeric and heterodimeric DNA-binding proteins. Mol Cell Biol. 1994;14:1230–1244. doi: 10.1128/mcb.14.2.1230. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 47.Ricksten A, Olsson A, Andersson T, Rymo L. The 5′ flanking region of the gene for Epstein-Barr virus-encoded nuclear antigen 2 contains a cell type specific cis-acting regulatory element that activates transcription in transfected B-cells. Nucleic Acids Res. 1987;16:8391–8410. doi: 10.1093/nar/16.17.8391. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 48.Safrany G, Perry R P. Transcription factor RFX1 helps control the promoter of the mouse ribosomal protein-encoding rpL30 by binding to its alpha element. Gene. 1993;32:279–283. doi: 10.1016/0378-1119(93)90208-k. [DOI] [PubMed] [Google Scholar]
• 49.Savard M, Bélanger C, Tardif M, Gourde P, Flamand L, Gosselin J. Infection of primary human monocytes by Epstein-Barr virus. J Virol. 2000;74:2612–2619. doi: 10.1128/jvi.74.6.2612-2619.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 50.Sengupta P K, Ehrlich M, Smith B D. A methylation-responsive MDBP/RFX site is in the first exon of the collagen alpha 2 (I) promoter. J Biol Chem. 1999;274:36649–36655. doi: 10.1074/jbc.274.51.36649. [DOI] [PubMed] [Google Scholar]
• 51.Siegrist C A, Durand B, Emery P, David E, Hearing P, Mach B, Reith W. RFX1 is identical to enhancer factor C and functions as a transactivator of the hepatitis B virus enhancer. Mol Cell Biol. 1993;13:6375–6384. doi: 10.1128/mcb.13.10.6375. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 52.Sinclair A J, Palmero I, Paters G, Farrell P J. EBNA-2 and EBNA-LP co-operate to cause G0 to G1 transition during immortalization of resting human B lymphocytes by Epstein-Barr virus. EMBO J. 1994;14:3321–3328. doi: 10.1002/j.1460-2075.1994.tb06634.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 53.Sixbey J W, Vesterinen E H, Nedrud J G, Raab-Traub N, Walton L A, Pagano J S. Replication of Epstein-Barr virus in human epithelial cells infected in vitro. Nature. 1983;306:480–483. doi: 10.1038/306480a0. [DOI] [PubMed] [Google Scholar]
• 54.Steimle V, Otten L A, Zufferey M, Mach B. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome) Cell. 1993;75:135–146. [PubMed] [Google Scholar]
• 55.Steimle V, Durand B, Barras E, Zufferey M, Hadam M R, Mach B, Reith W. A novel DNA binding regulatory factor is mutated in primary MHC class II deficiency (bare lymphocyte syndrome) Genes Dev. 1995;9:1021–1032. doi: 10.1101/gad.9.9.1021. [DOI] [PubMed] [Google Scholar]
• 56.Sung N S, Kenney S, Gutsch D, Pagano J S. EBNA-2 transactivates a lymphoid-specific enhancer in the BamHI C promoter of the Epstein-Barr virus. J Virol. 1991;65:2164–2169. doi: 10.1128/jvi.65.5.2164-2169.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 57.Tanner J, Weiss J, Fearon D, Whang Y, Kieff E. Epstein-Barr virus gp350/220 binding to the B lymphocyte C3d receptor mediates adsorption, capping, and endocytosis. Cell. 1987;50:203–213. doi: 10.1016/0092-8674(87)90216-9. [DOI] [PubMed] [Google Scholar]
• 58.Tierney R J, Steven N, Young L S, Rickinson A B. Epstein-Barr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state. J Virol. 1994;68:7374–7385. doi: 10.1128/jvi.68.11.7374-7385.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 59.Urbánek P, Wang Z-Q, Fetka I, Wagner E F, Busslinger M. Complete block of early B cell differentiation and altered patterning of the posterior midbrain in mice lacking Pax5/BSAP. Cell. 1994;79:901–912. doi: 10.1016/0092-8674(94)90079-5. [DOI] [PubMed] [Google Scholar]
• 60.Villard J, Muhlethaler-Mottet A, Bontron S, Mach B, Reith W. CIITA-induced occupation of MHC class II promoters is independent of the cooperative stabilization of the promoter-bound multiprotein complexes. Int Immunol. 1999;11:461–469. doi: 10.1093/intimm/11.3.461. [DOI] [PubMed] [Google Scholar]
• 61.Wang F, Gregory C D, Rowe M, Rickinson A B, Wang D, Birkenbach M, Kikutani H, Kishimoto T, Kieff E. Epstein-Barr virus nuclear antigen 2 specifically induces expression of the B-cell activation antigen CD23. Proc Natl Acad Sci USA. 1987;84:3452–3456. doi: 10.1073/pnas.84.10.3452. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 62.Wang F, Tsang S F, Kurilla M G, Cohen J I, Kieff E. Epstein-Barr virus nuclear antigen 2 transactivates a cis-acting CD23 DNA element. J Virol. 1990;65:4101–4106. doi: 10.1128/jvi.65.8.4101-4106.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 63.Watry D, Hedrick J A, Siervo S, Rhodes G, Lamberti J J, Lambris J D, Tsoukas C D. Infection of human thymocytes by Epstein-Barr virus. J Exp Med. 1991;173:971–980. doi: 10.1084/jem.173.4.971. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 64.Woisetschlaeger M, Yandava C N, Furmanski L A, Strominger J L, Speck S H. Promoter switching in Epstein-Barr virus during the initial stages of infection of B lymphocytes. Proc Natl Acad Sci USA. 1990;87:1725–1729. doi: 10.1073/pnas.87.5.1725. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 65.Zajac-Kaye M, Gelmann E P, Levens D. A point mutation in the c-myc locus of a Burkitt lymphoma abolishes binding of a nuclear protein. Science. 1988;240:1776–1779. doi: 10.1126/science.2454510. [DOI] [PubMed] [Google Scholar]
• 66.Zimber-Strobl U, Suentzewich K O, Laux G, Erik D, Cordier M, Calender A, Billaud M, Lenoir G, Bornkamm G. Epstein-Barr virus nuclear antigen 2 activates transcription of the terminal protein gene. J Virol. 1991;65:415–423. doi: 10.1128/jvi.65.1.415-423.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 67.Zimber-Strobl U, Strobl L J, Meitinger C, Hinrichs R, Sakai T, Furukawa T, Honjo T, Bornkamm G. Epstein-Barr virus nuclear antigen 2 exerts its transactivating function through the interaction with recombination signal binding protein RBP-J kappa, the homologue of Drosophila Suppressor of Hairless. EMBO J. 1994;13:4973–4982. doi: 10.1002/j.1460-2075.1994.tb06824.x. [DOI] [PMC free article] [PubMed] [Google Scholar]