Tau Reduction Prevents Neuronal Loss and Reverses Pathological Tau Deposition and Seeding in Mice with Tauopathy

Human Tau Antisense Oligonucleotides Reduce Human Tau mRNA in mice

Human tau ASOs were designed to be specific for human tau and targeted the coding 1N4R transgene of human tau expressed in the PS19 mouse model, which expresses human tau carrying the P301S mutation (16). Before testing human tau ASOs, we tested whether a scrambled ASO with the same chemistry would alter human tau or murine tau mRNA expression at several time points after ASO administration. PS19 mice treated with saline vehicle or scrambled ASO (30ug/day for 28 days; total 840μg) were tested at 4, 8, and 12 weeks after implantation of a pump for ASO delivery and both human atu and murine tau mRNA was measured. No significant differences were seen at any of the time points for either human tau (one-way ANOVA, Sidak post-hoc: 4wk p=0.968, 8wk p=0.926, 12wk p=0.331) or murine tau mRNA (one-way ANOVA, Sidak post-hoc: 4wk p=0.948, 8wk p=0.824, 12wk p=0.501) (Fig. S1).

We next tested the duration of action of the human tau-specific ASO (Tau^ASO-12) in preparation for a three month treatment to reduce human tau. Alzet osmotic pumps were implanted in PS19 mice, allowing for slow infusion of a control [saline vehicle or 30μg/day (total 840μg) scrambled ASO] treatment (4wk n=10; 8wk n=5; 12wk n=8) or 30μg/day (total 840μg) Tau^ASO-12 human tau reduction treatment (4wk n=3; 8wk n=5; 12wk n=11) for 28 days. Total human tau mRNA was significantly reduced at 4, 8, and 12 weeks post-pump implantation in Tau^ASO-12 treated mice (Fig. 1A) (two-way ANOVA F_1,43=22.96, p<0.0001, Bonferroni post-hoc: 4wk p=0.0250, 8wk p=0.0448, 12wk p<0.0001). Murine tau mRNA was not significantly altered (Fig. 1B) (two-way ANOVA F_1,43=1.27, p=0.267, Bonferroni post-hoc: 4wk p=0.265, 8wk p>0.999, 12wk p>0.999). There was no difference in either human tau (two-tailed student t-test, p=0.703) or murine tau (two-tailed student t-test, p=0.496) mRNA between saline and scrambled ASO control treatments, and thus these values were combined as single control values. The long duration of target mRNA reduction seen here corresponds with studies using similar RNase-H ASOs (15, 18). Thus, a one-month infusion of scrambled ASO or Tau^ASO-12 at 30μg/day was selected in all subsequent studies in order to ensure 12 weeks of human tau mRNA reduction.

ASOs Are Distributed Throughout the Adult Murine Brain

After one month of saline or ASO infusion at 30μg/day followed by an 8 week washout period, mouse brains were stained for the ASO itself using an antibody that recognized the backbone chemistry of ASOs, regardless of sequence (15, 18). Tau^ASO-12 diffused throughout the mouse brain and visibly persisted to the end of the 12-week treatment period (Fig. 1C; Fig. S2) (15, 18).

Tau ASO Treatment Prevents AT8-positive Tau Deposition

Tau pathology first deposits at 5–6 months of age in PS19 mice. To assess whether Tau^ASO-12 can prevent pathology from developing, scrambled ASO (n=5) or Tau^ASO-12 (n=10) was administered at 6 months of age. Pumps were removed 1 month after implantation, and mouse brain tissue was collected 2 months later. Age-matched non-transgenic littermate controls were treated with scrambled ASO (n=7). Human tau mRNA (one-way ANOVA, Sidak post-hoc p=0.004; Fig. S3A) and human tau protein (one-way ANOVA, Sidak post-hoc p=0.011; Fig. 1D) was significantly reduced in the Tau^ASO-12 group compared to the scrambled control group. Brains were then stained with the phospho-tau antibody AT8. PS19 mice treated with scrambled ASO showed extensive AT8-positive tau deposition by 9 months of age, particularly in the hippocampus and entorhinal/piriform cortex (Fig. 1G,H). Tau^ASO-12 treatment greatly reduced the amount of AT8 tau pathology deposition in the hippocampus (one-way ANOVA, Sidak post-hoc p=0.0003) (Fig. 1E, I) and in whole brain sections (one-way ANOVA, Sidak post-hoc p=0.008) (Fig. 1F, J).

Tau ASO Treatment Reverses Tau Inclusions in Aged PS19 Mice

To test whether reducing total human tau could reverse pre-existing tau aggregates, we treated aged 9 month old PS19 mice with 30μg/day Scrambled (n=6) or Tau^ASO-12 (n=6) ASO for 1 month, followed by a 2 month washout period (non-transgenic control group, n=5). In this older cohort, human tau mRNA (p=0.0003, one-way ANOVA, Sidak post-hoc; Fig. S3B) as well as total human tau protein was significantly reduced after Tau^ASO-12 treatment (p=0.024, one-way ANOVA, Sidak post-hoc; Fig. 2A). Further, we examined sarkosyl insoluble tau and found a significant decrease in total insoluble tau in Tau^ASO-12 treated aged PS19 mice (p=0.006, two-tailed t-test) (Fig. 2B, C). The lysate was further analyzed using semi-denaturing detergent agarose gel electrophoresis (SDD-AGE) to determine if high molecular weight (HMW) tau oligomers were also reduced. Lysate from 9–12 month old treated PS19 mice was run on SDD-AGE and probed for total tau and PHF-1 positive phospho-tau (recognizing pS396/pS404) (Fig. 2D–H). There was a reduction in total HMW tau oligomers (p=0.004, two-tailed t-test) and phospho-tau (p=0.0104, two-tailed t-test) in the Tau^ASO-12 treated mice.

PS19 mice at 9 months of age also showed extensive AT8 tau pathology throughout the hippocampus and cortex. This baseline pathology enabled a direct comparison of 9–12 month old treated mice with the 9 month starting point to determine if tau pathology could be reversed. 9–12 month old PS19 mice treated with Tau^ASO-12 showed substantially less AT8 staining in the hippocampus and the whole brain compared to both age-matched 12 month old PS19 mice treated with scrambled ASO and untreated mice (one-way ANOVA, Sidak post-hoc: hippocampus p<0.0001, whole brain p<0.0001), as well as the 9 month old PS19 mice starting group (one-way ANOVA, Sidak post-hoc: hippocampus p=0.028, whole brain p=0.011) (Fig. 2I–P; Fig. S4). These data suggested that when total human tau was reduced, pre-existing neuronal tau could be cleared from neurons in vivo. When stained for neurofibrillary tangles using Thioflavin S, a similar pattern emerged with Tau^ASO-12 treated PS19 mice showing a reversal of neurofibrillary tangle pathology (one-way ANOVA, Sidak post-hoc: 9–12 PS19 ASO-12 vs 6–9 PS19 Scrambled ASO p=0.0486; 9–12 PS19 ASO-12 vs 9–12 PS19 Scrambled ASO p=0.0078) (Fig. 2Q; quantification, Fig. S5).

In addition to measuring tau pathology burden, we stained for glial fibrillary acidic protein (GFAP) as a means to assess inflammation. Inflammation has been implicated in the pathogenesis of AD (23, 24) and the PS19 mouse model has been shown to develop an age-dependent increase in the activation of astrocytes and GFAP expression (16, 25). In PS19 mice treated with Tau^ASO-12, GFAP staining was substantially reduced as compared to 12 month old untreated PS19 mice (Fig. S6A–C).

Hippocampal Volume and Neuronal Loss are Prevented After Human Tau Reduction

PS19 mice show an age-dependent decrease in total hippocampal volume and increase in hippocampal neuron loss (7, 16), first evident at 9 months of age. In 9–12 month old Tau^ASO-12 treated PS19 mice, further hippocampal volume and entorhinal cortex area loss was prevented when compared to 9–12 month old PS19 mice treated with Scrambled ASO (hippocampus: p=0.009 one-way ANOVA, Sidak post-hoc; entorhinal cortex: p<0.0001 one-way ANOVA, Sidak post-hoc) (Fig. 3A, C; Fig. S7). To determine whether prevention of hippocampal volume loss was secondary to prevention of neuronal loss, we counted DAPI (blue) and NeuN (red; a marker for neurons) dual positive cells in the CA1 region of the hippocampus (Fig. 3B, D) and cell size area in CA1 (Fig. S8). We confirmed prevention of further neuronal loss as measured by NeuN positive cell counts in the hippocampus following treatment with Tau^ASO-12 in aged PS19 mice (DAPI and NeuN dual positive cells: p=0.005 one-way ANOVA, Sidak post-hoc; cell size: p<0.0001 one-way ANOVA, Sidak post-hoc).

Reducing Human Tau Prevents and Reverses Tau Seeding Capability

Recent studies have demonstrated the ability of tau to propagate from one cell to another in vitro (26) and from one brain region to another along synaptically-connected networks in vivo (27, 28). This tau “spreading” may be a mechanism for disease progression in AD and other tauopathies (29). One in vitro measure of the ability of pathological tau aggregates to induce misfolding of naïve monomeric tau, i.e. tau “seeding” activity, is a cell-based assay that relies on flow cytometry detection of Forster resonance energy transfer (FRET) created by intracellular aggregation of endogenously expressed repeat domain of tau (Tau^RD) fused with cyan fluorescent protein (Tau^RD-CFP) and yellow fluorescent protein (Tau^RD-YFP) in stably expressing human embryonic kidney (HEK-293) cells (30, 31) (Fig. 4A). Using Tau^RD-CFP/Tau^RD-YFP expressing HEK-293 cells, in non-transfected cells or cells treated with non-transgenic brain homogenate lysate, only diffuse homogenous background fluorescence and no FRET-positive inclusions were seen (Fig. 4B, C). Upon addition of brain lysate from the 6–9 month old and 9–12 month old PS19 treatment cohorts, intracellular Tau^RD-CFP/Tau^RD-YFP aggregates were seen at 24 hours after lysate was applied. Tau^ASO-12 treatment prevented tau aggregate formation in both 6–9 month old and 9–12 month old age groups (Fig. 4D–G) (one-way ANOVA, Sidak post-hoc: 6–9 month old mice p<0.0001, 9–12 month old mice p=0.0061). Additionally, when compared to the starting age of 9 months, tau seeding activity was reversed in the 9–12 month old PS19 cohort treated with Tau^ASO-12 (p=0.044 one-way ANOVA, Sidak post-hoc) (Fig. 4H). These data demonstrate that tau seeding activity is substantially reduced and partially reversed by treatment with tau ASO.

Lowering Human Tau Prolongs Mouse Survival and Rescues Nesting Deficits

Hind limb paralysis in PS19 mice begins around 9–10 months of age, leading to shortened survival time (16). We treated 9 month old PS19 mice with either Scrambled ASO or Tau^ASO-12 in the same treatment approach as for the 9–12 month old cohort to determine if survival could be extended, even in this older cohort (n=17 per treatment). Mice were sacrificed when they could not flip over in 30 seconds. Despite this late treatment strategy, Tau^ASO-12 treated mice lived significantly longer than age-matched controls treated with scrambled ASO (Mantel-Cox Survival, p=0.0052; Median survival, scrambled: 312 days, Tau^ASO-12: 348 days) (Fig. 5A).

In addition to survival, we assessed the ability of treated PS19 mice to complete a functional task. We sought to test the functionality of the mice and found nest building performance a robust and reliable readout of general performance in PS19 mice. In mouse models, instinctual nest building behavior is used to jointly assess general social behavior, cognitive performance, and motor capabilities. Deficits in nesting activity are evident in mouse models of tauopathy (34), suggesting that accumulation of tau can induce deficits in nesting practices. Mouse nesting deficits are characterized by incomplete nests (low nest score) and high untorn weight of the nestlet (3 gram piece of pressed cotton). 8–9 month old PS19 mice were treated with saline (n=11), scrambled ASO (n=11), or Tau^ASO-12 (n=25) at 30μg/day for 4 weeks and then the implanted Alzet osmotic pumps were removed. Six weeks after pump removal, nesting activity was assessed. No significant difference was seen between PS19 mice treated with saline and scrambled ASO, so these data were combined (nestlet weight: Two-tailed student t-test, p=0.366; nestlet score: Two-tailed Mann Whitney, p=0.311). Mice treated with Tau^ASO-12 performed significantly better on the nestlet task, both making better nests (p=0.040 Kruskal-Wallis, Dunn’s post-hoc) and leaving less untorn nestlet weight behind (p=0.014 one-way ANOVA, Sidak post-hoc) (Fig. 5B, C). Functional deficits as depicted by survival and nesting activity in aged PS19 mice served as a practical alternative for traditional cognitive performance and could be rescued by reducing total human tau in vivo (Fig. 5A–C).

Tau ASOs Reduce Tau in a Non-Human Primate

Cynomologus monkeys were treated with an ASO complementary to monkey tau. All monkeys were 2–8 years old at the start of treatment. Artificial cerebrospinal fluid – a solution made to mimic the molecular composition of biological cerebrospinal fluid – (n=4) or the ASO was delivered in a single bolus via lumbar puncture into the intrathecal space at doses of 30mg (n=3) or 50mg (n=3) and the brains and spinal cords were collected two weeks later (Fig. 6A). Total tau mRNA was decreased across the spinal cord and brain in a dose-dependent manner (Fig. 6B). Next, we looked at tau mRNA and protein in the brain and spinal cord after both a short (2 weeks; n=4 per treatment) and long (6 weeks; n=4 per treatment) duration post initial dose. An initial intrathecal bolus of 10mg ASO was delivered, followed by a second 30mg ASO intrathecal bolus one week later (Fig. 6C). At two weeks after ASO treatment, tau mRNA was effectively decreased (Fig. 6D). Protein was also decreased, though not to the same degree, likely due to the long half-life of tau (35) (Fig. 6E). The longer six week duration showed both continued tau mRNA reduction as well as improved tau protein reduction compared to the two week duration (Fig. 6D, E). Despite delivery of the ASO as a bolus in the intrathecal space, tau was suppressed just as efficiently in the entire hippocampus as it was in the cervical portion of the spinal cord, demonstrating widespread intrathecal delivery of ASO in the brain of a larger mammalian species.

Finally, we tested the effect of the ASO on tau protein in the cerebrospinal fluid as a possible marker to monitor therapeutic efficacy (36). Non-human primates were dosed with 10mg ASO via intrathecal bolus injection, followed one week later by a 30mg ASO bolus. Brains and spinal cords were collected 5 weeks after the initial dose. Tau protein in the cerebrospinal fluid was measured both before dosing and at necropsy (Fig. 6F) (n=4 per treatment). Tau protein reduction in the spinal cord and in the frontal cortex, temporal cortex, and hippocampus was confirmed (Fig. 6G). Using the individual animal’s pre-dosing cerebrospinal fluid tau as a baseline, tau protein in the cerebrospinal fluid was found to be decreased following tau ASO treatment (Fig. 6H). Cerebrospinal fluid tau correlated directly with tau protein in the hippocampus (p=0.01, R²=0.68, Linear Regression, Fig. 6J; for other regions see Fig. S9), one of the major affected regions in the AD brain.

Study Design

The goal of the study was to treat adult PS19 mice with a human tau lowering antisense oligonucleotide (ASO) and analyze the effects of tau reduction on tau pathology, inflammation, neuronal loss, tau seeding, and functional behavior. The first portion of the study focused on treatment with Tau^ASO-12 directed against human tau and used PS19 mice – a tauopathy mouse model that overexpresses a mutant form of human tau – and their non-transgenic littermate controls. For all studies, mice were litter-matched, age-matched, and gender matched to keep the treatment groups as similar as possible. Except for the duration of action study where the mice were euthanized at different time points, all studies were pre-determined to last three months from pump implantation. Each age group – 6–9 month old and 9–12 month old – was processed together and all brains across both age groups were stained and imaged at the same time. The tau seeding assay was carried out in human embryonic kidney (HEK-293) cells that stably expressed the repeat domain of tau (Tau^RD) fused with CFP and Tau^RD fused with YFP (30). Sample sizes were chosen based both on previous experience with tau ASOs in the lab as well as therapeutic studies carried out by others using the same PS19 mouse line. The tau seeding analyses, quantification of AT8 staining, hippocampal and entorhinal volume, NeuN/DAPI counts, cell size analysis, survival, and nestlet behavior were all carried out blinded. The last part of the study used Cynomologus non-human primates (n=34 total) to determine the extent of tau mRNA and protein reduction following a lumbar infusion of tau ASO in a large mammal.

Animals

The PS19 mice were created using a 1N4R tau cDNA with a Tau^P301S mutation resulting in 5-fold greater human tau expression over endogenous mouse tau (16). Breeding pairs were purchased from The Jackson Laboratory and resulting progenies were maintained on a B6C3 background. All non-transgenics used were littermates of PS19 mice. All studies were performed using gender-balanced groups. Mice had access to food and water ad libitum and were housed on a 12 hour light:dark cycle. Experiments involving animals were approved by the Animal Studies Committee at Washington University in St. Louis.

Antisense Oligonucleotides

The ASOs used have the following modifications: five nucleotides on the 5′- and 3′-termini containing 2′-O-methoxyethyl modifications and 10 unmodified central oligodeoxynucleotides to support RNaseH activity and a phosphorothioate backbone to improve nuclease resistance and promote cellular uptake (59). ASOs were synthesized as previously described (60) and solubilized in 0.9% sterile saline immediately prior to use. For murine use: Tau^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′; Scrambled sequence – 5′ CCTTCCCTGAAGGTTCCTCC 3′. For Non-Human Primate work: Tau ASO sequence – 5′ CCGTTTTCTTACCACCCT 3′.

Surgical Placement of Intracerebroventricular (ICV) Pumps and Tissue Collection

As previously described, (17, 61) mice were anesthetized with isoflurane and 28 day osmotic pumps (ALZET) with ASO were implanted in a subcutaneous pocket formed on the back of the mouse. The catheter was placed in the right lateral ventricle with following coordinates based on bregma: −0.5mm Posterior, −1.1mm Lateral (right), −2.5mm Ventral. For tissue collection, mice were anesthetized with isoflurane and perfused using chilled PBS-heparin. Brain tissue was rapidly removed and the right hemisphere (ipsilateral to the pump catheter placement) was snap frozen in liquid nitrogen and stored at −80°C while the left hemisphere (contralateral to the catheter placement) was post-fixed in 4% paraformaldehyde at 4°C and transferred to 30% sucrose 24 hours later. All animal protocols were approved by the Washington University in St. Louis Institutional Animal Care and Use Committee.

Quantitative Real-Time PCR

RNA analyses were performed using quantitative real-time RT-PCR. Total RNA was extracted from brain tissue using a QIAGEN RNeasy Kit (QIAGEN). For total tau analyses, RNA was reverse transcribed and amplified using the EXPRESS One-Step Superscript qRT-PCR Universal Kit (Invitrogen). The qRT-PCRs were run and analyzed on the ABI PRISM 7500 Fast Real-Time PCR System (Applied Biosystems). Total human and mouse tau expression levels were normalized to mouse GAPDH mRNA levels and analyzed using the ΔΔCt method for relative expression analysis. Primer/Probe sequences: Human Total Tau: Forward 5′-AGA AGC AGG CAT TGG AGA C-3′; Reverse 5′-TCT TCG TTT TAC CAT CAG CC -3′; Probe 5′-/56-FAM/ACG GGA CTG GAA GCG ATG ACA AAA/3IABkFQ/ - 3′, Mouse Total Tau: Forward 5′-GAA CCA CCA AAA TCC GGA GA -3′; Reverse 5′-CTC TTA CTA GCT GAT GGT GAC -3′; Probe 5′-/56-FAM/CCA AGA AGG TGG CAG TGG TCC/3IABkFQ/ - 3′, GAPDH: Forward 5′ – TGC CCC CAT GT TGT GAT G 3′; Reverse 3′ – TGT GGT CAT GAG CCC TTC C – 3′; Probe 5′/56-FAM/ AAT GCA TCC TGC ACC ACC AAC TGC TT /3IABkFQ/ 3′ (IDT).

Tau ELISA Analysis

Tissues were homogenized in RAB buffer [100mM MES, 1mM EDTA, 0.5mM MgSO4, 750mM NaCl, 20mM NaF, 1mM Na3VO4, supplemented with protease inhibitor (Complete, Roche)]. Homogenate was spun at 40,000xg on an ultracentrifuge for 20mins at 4°C. Supernatant was collected and protein concentration measured using Pierce BCA Protein Assay Kit (Thermo Scientific). Total Human Tau protein levels were measured on a Tau5-HT7 sandwich ELISA. 96-half-well plates (Nunc) were coated with the Tau-5 antibody (anti-mouse; Millipore) overnight at 4°C. Plates were blocked with 4% BSA for 60min at 37°C, brain homogenate diluted in standard buffer [0.25% BSA, 300mM Tris, 0.05% azide, and 1X protease inhibitor in PBS] was added, and incubated overnight at 4°C. For the standard curve, hTau2N4R recombinant protein was used. The detection antibody biotinylated HT7 (anti-mouse; ThermoScientific) was added the next day followed by streptavidin poly-horseradish peroxidase-40 (Fitzgerald). Plates were developed using Super Slow ELISA TMB (Sigma) and read on an Epoch Microplate Spectrophotometer (BioTek).

Sarkosyl Insoluble Tau Analysis

The Sarkosyl extraction was carried out as previously described (62). Briefly, tissue was homogenized in Buffer H (20mM Tris-HCl pH7.5, 0.15M NaCl, 1mM EGTA, 1mM DTT) with electronic hand held homogenizer and then spun at 100,000xg for 30mins at 4°C in the ultracentrifuge. Supernatant was removed, pellet was resuspended in Buffer H, and homogenized again. Samples were then incubated with 1% Triton X-100 at 37°C for 30mins. Samples were spun at 100,000xg for 30mins at 4°C and supernatant removed. Pellet was resuspended in Buffer H and homogenized. Samples then incubated with 1% sarkosyl at 37°C for 30mins. After the incubation, samples spun at 100,000xg for 30mins at 4°C. Supernatant removed and stored as the sarkosyl-soluble fraction. The pellet was resuspended in urea buffer (8M urea, 50mM Tris-HCl pH7.5) and sonicated. Samples were again spun at 100,000xg for 30mins at 4°C. This supernatant was collected and used as the sarkosyl insoluble fraction. Protein concentration was measured on BCA (Peirce). 5μg of sarkosyl insoluble fraction and 6μg of TritonX soluble fraction was loaded onto a 4–20% SDS-PAGE gel and transferred to PVDF membrane. Tau13 (anti-mouse; 1:1000, Abcam) was used to detect total human tau on the sarkosyl insoluble blot and Actin (anti-mouse; 1:2000, Abcam) was used on the TritonX soluble blot as a loading control. Primary antibody was incubated at room temperature in 1:1 Odyssey blocking buffer:water for 3 hours. Membranes were washed 3X with TBS-Tween, probed with goat anti-mouse IRdye 800 (1:2000; Licor) for 1.5 hours at RT, washed 3X in TBS-Tween and developed on the Odyssey CLx Imager (Licor). Bands were quantified using ImageJ software.

Semi-Denaturing Detergent Agarose Gel Electrophoresis (SDD-AGE)

The SDD-AGE protocol was carried out previously described (63) with minor modifications. Brain protein used for SDD-AGE analysis was collected by dounce homogenizing tissue in 1X PBS supplemented with protease inhibitor and spun at 3,000xg for 5mins at 4°C. The supernatant was collected and protein concentration measured by BCA (Pierce). The gel was composed of 1.5% agarose dissolved in buffer G (20mM Tris-Base, 200mM glycine) and 0.02% SDS added after the agarose was fully dissolved. Gels were cast to be 20cm long. 50μg of total lysate was then incubated with 0.02% SDS sample buffer for 7 minutes at room temperature immediately prior to loading. Once loaded, the SDD-AGE was run using Laemmli buffer (Buffer G + 0.1% SDS) at 30V for 16 hours. The transfer was performed using capillary action using 20 pieces of thick Whatmann paper (GB 005) and 8 pieces of medium high absorbent Whatmann paper (GB 003) to Immoblin PVDF (Millipore) membrane at 4°C for 24 hours using 1X TBS. Following transfer, the membrane was blocked in Odyssey Blocking Buffer PBS (Li-cor) for 1 hour and then probed for both total tau (anti-rabbit; 1:4000; Abcam) and PHF-1 (anti-mouse; gift from Peter Davies, 1:5000) overnight at 4°C in 1:1 Odyssey blocking buffer:water. The membrane was washed 3X with TBS-Tween, probed with goat anti-rabbit IRdye 680 (1:2000; Licor) and goat anti-mouse IRdye 800 (1:2000; Licor) for 1.5 hours at room temperature, washed 3X in TBS-Tween and developed on the Odyssey CLx Imager (Licor). To quantify the bands, the low molecular weight (LMW) and high molecular weight (HMW) portions of the blot were quantified separately. Previous reports of HMW and LMW tau run on SDD-AGE show an accumulation of LMW tau at the bottom of the gel with smears of HMW tau oligomers at the top (7, 63–65). Using ImageJ gel quantification tool, each region – either HMW or LMW – was outlined and plotted. The middle empty lane was used to subtract background from all samples.

Immunofluorescence

Brains post-fixed in 4% paraformaldehyde were sliced at 50μm on a freezing microtome. Brains were incubated with the primary antibodies Pan-ASO (anti-rabbit; 1:2000, Ionis), AT8 (anti-mouse; 1:500, Thermo Scientific), NeuN (anti-rabbit; 1:100, Abcam), or glial fibrillary acidic protein (GFAP) (anti-chicken; 1:1000, Abcam) in 3% Horse Serum 1X TBS 0.1% Triton overnight at 4°C, followed by a 1 hour incubation at room temperature with fluorescent-conjugated secondary antibodies (1:400 anti-mouse DyLight 488, 1:400 anti-rabbit DyLight 550, ThermoScientific). All sections were counterstained with DAPI for 5 minutes immediately following secondary incubation, mounted onto slides, and cover slipped using Vectashield mounting solution (Vector Labs). Fluorescent images were captured using the Olympus Nanozoomer 2.0-HT (Hamamatsu) and processed using the NDP viewer software (Hamamatsu). All images were taken with the same fluorescent settings and subsequently adjusted equally for brightness and contrast to ensure accurate pathology quantification.

Thioflavin S Staining

Four brain sections 300μm apart were used from each mouse. Staining for all sections analyzed were carried out on the same day and imaged together to reduce staining batch variability. 50μm fixed brain sections were mounted onto slides and dried overnight. Slides were then incubated with fresh/filtered 0.05% Thioflavin S in 50% ethanol for 8 minutes in the dark, followed by dipping in 80% ethanol for 15 seconds. Slides were washed in double distilled water 5 times, 5 minutes each in the dark. Sections were coverslipped with Vectashield mounting medium with Propidium Iodide (Vector Labs) and sealed with nail polish. Images were obtained using the 488 channel on an Olympus BX51 microscope mounted with a DP 70 Olympus digital camera. The number of ThioS positive cells were counted in the Piriform Cortex of each section and averaged together over the four sections for each mouse, resulting in one value per mouse.

Tau Pathology Quantification

All pathology quantification was carried out blinded. For AT8 pathology staining, 4 brain sections 300μm apart were used from each mouse. Staining for all sections analyzed were carried out on the same day and imaged together to reduce staining batch variability. The sections were used to assess the percent area covered by AT8 positive tau staining. Following imaging, using sections incubated only with secondary antibody, the brightness and contrast were adjusted using the NDP viewer software (Hamamatsu) to eliminate background so the AT8 positive signal could be seen more clearly. Those exact same settings were then applied to all subsequent image files before being exported and saved as .jpeg image files. The image files were opened in ImageJ, converted to 8 bit greyscale and re-saved. Using the freehand selection tool on the greyscale images, the outline of either the whole brain section or the hippocampus was drawn. A uniform threshold value of 6 (using the dark background option) was then applied before performing the “analyze particles” task to determine within the outline area the percent covered by positive signal. The average percent coverage of all four sections was used as the final percent AT8 stained value for that mouse.

Hippocampal Volume and Entorhinal Cortex Analysis

All hippocampal volume and entorhinal cortex analyses were carried out blinded. Starting at the very beginning of the hippocampus (bregma −1.0mm), 8 sections were taken at 300μm apart. Sections were mounted and stained with Crystal Violet before imaging on the Olympus Nanozoomer 2.0-HT (Hamamatsu). Using the NDP viewer software, the hippocampus in each section was outlined to obtain the total hippocampal area. Each of the hippocampal areas was then multiplied by 300μm to obtain a final hippocampal volume in mm³ for each mouse. For the entorhinal cortex, only sections posterior of bregma −2.70mm were used. The entire cortex area ventral to the rhinal fissure was outlined and area measured. This area was averaged across sections to get a final entorhinal/piriform area.

DAPI Count and Cell Size Analysis

For DAPI counts, a rectangle was placed over CA1 in ImageJ. Using a macro, the same size rectangle was used for each section to ensure the same area. The numbers of DAPI positive nuclei that colocalized with the NeuN neuronal marker were blindly counted within the defined CA1 region. For cell size analysis, 3 sections per mouse were subjected to Crystal Violet staining and imaged using the Olympus Nanozoomer 2.0-HT (Hamamatsu). To measure cell size area, 25 adjoining cells in CA1 spanning an average of 100μm (approximately 8% of the total length of CA1) of the hippocampus in each section were outlined using the NDP viewer software at a magnification of 40X and the area of each of those cells was measured. The cell size area of those 25 cells was averaged for each section and those averages for the three sections were then averaged for each mouse, generating a single cell size area value for each animal.

Tau Seeding Assay

In vitro tau seeding activity was measured as previously described (30, 31). Briefly, HEK-293 cells stably expressing the repeat domain of Tau with the P301S mutation (TauRD^P301S) fused with cyan fluorescent protein (CFP) and TauRD^P301S–yellow fluorescent protein (YFP) were plated in 96-well plates at 35,000 cells per well. Approximately 18 hours later, at 60% confluency, cells were transduced with the experimental PS19 brain lysate at 4μg/well. The transduction complexes were generated by incubating Opti-MEM (Gibco) + 4μg lysate with Opti-MEM + 1.25μL Lipofectamine 2000 (Invitrogen) for a final volume of 20μL per well for 20 minutes at room temperature. Transduction complexes were added to cells for 24 hours and then cell harvested with 0.05% trypsin followed by post-fixing in 2% paraformaldehyde (Electron Microscopy Services) for 10 minutes. Cells were then resuspended in flow cytometry buffer. For all flow cytometry measurements, the MACSQuant (Miltenyi) flow cytometer was used. CFP and FRET were measured by exciting cells with the 405nm laser and capturing fluorescence with the 405/50 and 525/50nm filters, respectively. For FRET quantification, a bivariate plot of FRET vs. CFP was generated to assess the number of FRET-positive cells, using cells that received lipofectamine alone as a marker of the FRET-negative population. The integrated FRET density (percentage of FRET-positive cells multiplied by the median fluorescence intensity of FRET-positive cells) was used for all quantitative analyses. Each experiment was performed using 20,000 cells per replicate and each sample was analyzed in triplicate. Data analyses were performed with FlowJo v10 (Treestar). Representative images of tau aggregates in the HEK dual positive cells were taken using a confocal microscope with the BP 505–530 filter.

Survival Analysis

9 month old PS19 mice were treated with either scrambled ASO or Tau^ASO-12 at 30μg/day for 28 days. Immediately following pump implantation, animals were monitored several days a week throughout the study. If a mouse showed signs of hindlimb paralysis, it was tested daily for its ability to right itself when placed on its back. Mice unable to flip over after 30 seconds were sacrificed.

Nestlet Behavior

To measure nesting capability, singly housed PS19 mice were given an intact, pre-weighed compressed cotton nestlet (3.0g; Ancare) in their cage. After 24 hours, pictures were taken of each nest and any untorn nestlets were removed, dried overnight at 37°C, and weighed. Nest quality was scored on a scale of 0 to 7, with slight modifications and increased scale range compared to previously published criteria (66). A score of 7 is a perfect nest with no untorn nestlet remaining, while a score of 0 is an untouched nestlet. The untorn nestlets were weighed and nests scored by a blinded observer.

Non-Human Primate ASO Dosing

All non-human primate procedures were performed following animal welfare regulations of the institution. All non-human primates were 2–8 years old at the start of treatment. Intrathecal lumbar bolus injections were performed in Cynomolgus monkeys after anesthesia with Ketamine and Domitor (Antisedan used as an antidote). 10mg, 30mg, and 50mg doses of tau ASO were administered via lumbar puncture at level L3–L4 and infused over the course of 1 minute as a slow bolus. At the discretion of the study veterinarian, some doses were administered at the L5–L6 level as an alternative when the intrathecal space was not accessible at L3–L4. Neurological exams were performed following dosing and then again before necropsy. The spinal cord and brain were collected either 2 weeks, 5 weeks, or 6 weeks post-initial treatment, depending on the study, to analyze monkey tau mRNA and protein in different CNS tissues. Tissue homogenates were generated from full regions of the spinal cord – cervical, thoracic, and lumbar – and full brain regions – frontal cortex, temporal cortex, and hippocampus. Monkey tau protein was also measured in CSF that was drawn just prior to initial dosing as well as at necropsy.

Statistics

The data were analyzed for statistical significance using the graphing program GraphPad Prism 6. To determine sample size for tau reduction and pathology, a pilot cohort of n=5/treatment was analyzed and found to be sufficient to see significant differences in tau expression and pathology. Each study was completed with the listed number of mice in the figure legends. Two-tailed student t-tests were used for Sarkosyl and SDD-AGE blot quantifications. One-way ANOVA with Sidak post hoc analyses were used for saline vs scrambled mRNA analysis, total tau protein expression, AT8 pathology quantification, Thioflavin S pathology quantification, hippocampal volume and entorhinal area, DAPI counts and cell size analysis, tau seeding, nestlet weight, and monkey mRNA and protein analysis. For nestlet score, because the scoring was a non-ordinal scale, a Kruskal-Wallis test was performed with Dunn’s post hoc multiple comparison analysis. Two-way ANOVA with Bonferroni post hoc analyses were used for the duration of action study. A two-way repeated measures ANOVA with Sidak post hoc analysis was used to analyze changes in CSF tau protein in Cynomologus monkeys with each monkey serving as its own baseline. Linear regression was used for the correlations between Cynomologus CSF and Brain/Spinal Cord tau protein. Graphical data are represented as box and whisker plots with individual points overlaid, where error bars represent maximum and minimum values and the boxed line represents the median.

• 1.Braak H, Braak E. Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol. 1991;82:239–59. doi: 10.1007/BF00308809. [DOI] [PubMed] [Google Scholar]
• 2.Hyman BT, Van Hoesen GW, Damasio AR, Barnes CL. Alzheimer’s disease: cell-specific pathology isolates the hippocampal formation. Science. 1984;225:1168–70. doi: 10.1126/science.6474172. [DOI] [PubMed] [Google Scholar]
• 3.Nelson PT, Alafuzoff I, Bigio EH, Bouras C, Braak H, Cairns NJ, Castellani RJ, Crain BJ, Davies P, Del Tredici K, Duyckaerts C, Frosch MP, Haroutunian V, Hof PR, Hulette CM, Hyman BT, Iwatsubo T, Jellinger KA, Jicha GA, Kövari E, Kukull WA, Leverenz JB, Love S, Mackenzie IR, Mann DM, Masliah E, McKee AC, Montine TJ, Morris JC, Schneider JA, Sonnen JA, Thal DR, Trojanowski JQ, Troncoso JC, Wisniewski T, Woltjer RL, Beach TG. Correlation of Alzheimer disease neuropathologic changes with cognitive status: a review of the literature. J Neuropathol Exp Neurol. 2012;71:362–81. doi: 10.1097/NEN.0b013e31825018f7. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 4.Hosokawa M, Arai T, Masuda-Suzukake M, Nonaka T, Yamashita M, Akiyama H, Hasegawa M. Methylene blue reduced abnormal tau accumulation in P301L tau transgenic mice. PLoS One. 2012;7:e52389. doi: 10.1371/journal.pone.0052389. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 5.Min SW, Chen X, Tracy TE, Li Y, Zhou Y, Wang C, Shirakawa K, Minami SS, Defensor E, Mok SA, Sohn PD, Schilling B, Cong X, Ellerby L, Gibson BW, Johnson J, Krogan N, Shamloo M, Gestwicki J, Masliah E, Verdin E, Gan L. Critical role of acetylation in tau-mediated neurodegeneration and cognitive deficits. Nat Med. 2015;21:1154–62. doi: 10.1038/nm.3951. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 6.Myeku N, Clelland CL, Emrani S, Kukushkin NV, Yu WH, Goldberg AL, Duff KE. Tau-driven 26S proteasome impairment and cognitive dysfunction can be prevented early in disease by activating cAMP-PKA signaling. Nat Med. 2016;22:46–53. doi: 10.1038/nm.4011. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 7.Yanamandra K, Kfoury N, Jiang H, Mahan TE, Ma S, Maloney SE, Wozniak DF, Diamond MI, Holtzman DM. Anti-tau antibodies that block tau aggregate seeding in vitro markedly decrease pathology and improve cognition in vivo. Neuron. 2013;80:402–14. doi: 10.1016/j.neuron.2013.07.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 8.Castillo-Carranza DL, Sengupta U, Guerrero-Muñoz MJ, Lasagna-Reeves CA, Gerson JE, Singh G, Estes DM, Barrett ADT, Dineley KT, Jackson GR, Kayed R. Passive immunization with Tau oligomer monoclonal antibody reverses tauopathy phenotypes without affecting hyperphosphorylated neurofibrillary tangles. J Neurosci. 2014;34:4260–72. doi: 10.1523/JNEUROSCI.3192-13.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 9.Bi M, Ittner A, Ke YD, Götz J, Ittner LM. Tau-targeted immunization impedes progression of neurofibrillary histopathology in aged P301L tau transgenic mice. PLoS One. 2011;6:e26860. doi: 10.1371/journal.pone.0026860. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 10.Boimel M, Grigoriadis N, Lourbopoulos A, Haber E, Abramsky O, Rosenmann H. Efficacy and safety of immunization with phosphorylated tau against neurofibrillary tangles in mice. Exp Neurol. 2010;224:472–85. doi: 10.1016/j.expneurol.2010.05.010. [DOI] [PubMed] [Google Scholar]
• 11.Ittner A, Bertz J, Suh LS, Stevens CH, Götz J, Ittner LM. Tau-targeting passive immunization modulates aspects of pathology in tau transgenic mice. J Neurochem. 2015;132:135–45. doi: 10.1111/jnc.12821. [DOI] [PubMed] [Google Scholar]
• 12.Lei P, Ayton S, Finkelstein DI, Spoerri L, Ciccotosto GD, Wright DK, Wong BXW, Adlard PA, Cherny RA, Lam LQ, Roberts BR, Volitakis I, Egan GF, McLean CA, Cappai R, Duce JA, Bush AI. Tau deficiency induces parkinsonism with dementia by impairing APP-mediated iron export. Nat Med. 2012;18:291–5. doi: 10.1038/nm.2613. [DOI] [PubMed] [Google Scholar]
• 13.Morris M, Hamto P, Adame A, Devidze N, Masliah E, Mucke L. Age-appropriate cognition and subtle dopamine-independent motor deficits in aged tau knockout mice. Neurobiol Aging. 2013;34:1523–9. doi: 10.1016/j.neurobiolaging.2012.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 14.Li Z, Hall AM, Kelinske M, Roberson ED. Seizure resistance without parkinsonism in aged mice after tau reduction. Neurobiol Aging. 2014;35:2617–24. doi: 10.1016/j.neurobiolaging.2014.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 15.DeVos SL, Goncharoff DK, Chen G, Kebodeaux CS, Yamada K, Stewart FR, Schuler DR, Maloney SE, Wozniak DF, Rigo F, Bennett CF, Cirrito JR, Holtzman DM, Miller TM. Antisense reduction of tau in adult mice protects against seizures. J Neurosci. 2013;33:12887–97. doi: 10.1523/JNEUROSCI.2107-13.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 16.Yoshiyama Y, Higuchi M, Zhang B, Huang SM, Iwata N, Saido TC, Maeda J, Suhara T, Trojanowski JQ, Lee VMY. Synapse loss and microglial activation precede tangles in a P301S tauopathy mouse model. Neuron. 2007;53:337–51. doi: 10.1016/j.neuron.2007.01.010. [DOI] [PubMed] [Google Scholar]
• 17.Smith RA, Miller TM, Yamanaka K, Monia BP, Condon TP, Hung G, Lobsiger CS, Ward CM, McAlonis-Downes M, Wei H, Wancewicz EV, Bennett CF, Cleveland DW. Antisense oligonucleotide therapy for neurodegenerative disease. J Clin Invest. 2006;116:2290–6. doi: 10.1172/JCI25424. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 18.Kordasiewicz HB, Stanek LM, Wancewicz EV, Mazur C, McAlonis MM, Pytel KA, Artates JW, Weiss A, Cheng SH, Shihabuddin LS, Hung G, Bennett CF, Cleveland DW. Sustained therapeutic reversal of Huntington’s disease by transient repression of huntingtin synthesis. Neuron. 2012;74:1031–44. doi: 10.1016/j.neuron.2012.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 19.Schoch KM, DeVos SL, Miller RL, Chun SJ, Norrbom M, Wozniak DF, Dawson HN, Bennett CF, Rigo F, Miller TM. Increased 4R-Tau Induces Pathological Changes in a Human-Tau Mouse Model. Neuron. 2016;90:941–7. doi: 10.1016/j.neuron.2016.04.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 20.Lagier-Tourenne C, Baughn M, Rigo F, Sun S, Liu P, Li HR, Jiang J, Watt AT, Chun S, Katz M, Qiu J, Sun Y, Ling SC, Zhu Q, Polymenidou M, Drenner K, Artates JW, McAlonis-Downes M, Markmiller S, Hutt KR, Pizzo DP, Cady J, Harms MB, Baloh RH, Vandenberg SR, Yeo GW, Fu XD, Bennett CF, Cleveland DW, Ravits J. Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration. Proc Natl Acad Sci U S A. 2013;110:E4530–9. doi: 10.1073/pnas.1318835110. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 21.Donnelly CJ, Zhang PW, Pham JT, Haeusler AR, Heusler AR, Mistry NA, Vidensky S, Daley EL, Poth EM, Hoover B, Fines DM, Maragakis N, Tienari PJ, Petrucelli L, Traynor BJ, Wang J, Rigo F, Bennett CF, Blackshaw S, Sattler R, Rothstein JD. RNA toxicity from the ALS/FTD C9ORF72 expansion is mitigated by antisense intervention. Neuron. 2013;80:415–28. doi: 10.1016/j.neuron.2013.10.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 22.Miller TM, Pestronk A, David W, Rothstein J, Simpson E, Appel SH, Andres PL, Mahoney K, Allred P, Alexander K, Ostrow LW, Schoenfeld D, Macklin EA, Norris DA, Manousakis G, Crisp M, Smith R, Bennett CF, Bishop KM, Cudkowicz ME. An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomised, first-in-man study. Lancet Neurol. 2013;12:435–42. doi: 10.1016/S1474-4422(13)70061-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 23.Lee YJ, Han SB, Nam SY, Oh KW, Hong JT. Inflammation and Alzheimer’s disease. Arch Pharm Res. 2010;33:1539–56. doi: 10.1007/s12272-010-1006-7. [DOI] [PubMed] [Google Scholar]
• 24.Frank-Cannon TC, Alto LT, McAlpine FE, Tansey MG. Does neuroinflammation fan the flame in neurodegenerative diseases? Mol Neurodegener. 2009;4:47. doi: 10.1186/1750-1326-4-47. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 25.Saul A, Sprenger F, Bayer TA, Wirths O. Accelerated tau pathology with synaptic and neuronal loss in a novel triple transgenic mouse model of Alzheimer’s disease. Neurobiol Aging. 2013;34:2564–73. doi: 10.1016/j.neurobiolaging.2013.05.003. [DOI] [PubMed] [Google Scholar]
• 26.Holmes BB, DeVos SL, Kfoury N, Li M, Jacks R, Yanamandra K, Ouidja MO, Brodsky FM, Marasa J, Bagchi DP, Kotzbauer PT, Miller TM, Papy-Garcia D, Diamond MI. Heparan sulfate proteoglycans mediate internalization and propagation of specific proteopathic seeds. Proc Natl Acad Sci U S A. 2013;110:E3138–47. doi: 10.1073/pnas.1301440110. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 27.de Calignon A, Polydoro M, Suárez-Calvet M, William C, Adamowicz DH, Kopeikina KJ, Pitstick R, Sahara N, Ashe KH, Carlson GA, Spires-Jones TL, Hyman BT. Propagation of tau pathology in a model of early Alzheimer’s disease. Neuron. 2012;73:685–97. doi: 10.1016/j.neuron.2011.11.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 28.Liu L, Drouet V, Wu JW, Witter MP, Small SA, Clelland C, Duff K. Trans-synaptic spread of tau pathology in vivo. PLoS One. 2012;7:e31302. doi: 10.1371/journal.pone.0031302. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 29.Walker LC, Diamond MI, Duff KE, Hyman BT. Mechanisms of protein seeding in neurodegenerative diseases. JAMA Neurol. 2013;70:304–10. doi: 10.1001/jamaneurol.2013.1453. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 30.Holmes BB, Furman JL, Mahan TE, Yamasaki TR, Mirbaha H, Eades WC, Belaygorod L, Cairns NJ, Holtzman DM, Diamond MI. Proteopathic tau seeding predicts tauopathy in vivo. Proc Natl Acad Sci U S A. 2014;111:E4376–85. doi: 10.1073/pnas.1411649111. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 31.Furman JL, Holmes BB, Diamond MI. Sensitive Detection of Proteopathic Seeding Activity with FRET Flow Cytometry. J Vis Exp. 2015:e53205. doi: 10.3791/53205. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 32.Dumont M, Stack C, Elipenahli C, Jainuddin S, Gerges M, Starkova NN, Yang L, Starkov AA, Beal F. Behavioral deficit, oxidative stress, and mitochondrial dysfunction precede tau pathology in P301S transgenic mice. FASEB J. 2011;25:4063–72. doi: 10.1096/fj.11-186650. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 33.Takeuchi H, Iba M, Inoue H, Higuchi M, Takao K, Tsukita K, Karatsu Y, Iwamoto Y, Miyakawa T, Suhara T, Trojanowski JQ, Lee VMY, Takahashi R. P301S mutant human tau transgenic mice manifest early symptoms of human tauopathies with dementia and altered sensorimotor gating. PLoS One. 2011;6:e21050. doi: 10.1371/journal.pone.0021050. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 34.Torres-Lista V, Giménez-Llort L. Impairment of nesting behaviour in 3xTg-AD mice. Behav Brain Res. 2013;247:153–7. doi: 10.1016/j.bbr.2013.03.021. [DOI] [PubMed] [Google Scholar]
• 35.Yamada K, Holth JK, Liao F, Stewart FR, Mahan TE, Jiang H, Cirrito JR, Patel TK, Hochgräfe K, Mandelkow EM, Holtzman DM. Neuronal activity regulates extracellular tau in vivo. J Exp Med. 2014;211:387–93. doi: 10.1084/jem.20131685. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 36.Lleó A, Cavedo E, Parnetti L, Vanderstichele H, Herukka SK, Andreasen N, Ghidoni R, Lewczuk P, Jeromin A, Winblad B, Tsolaki M, Mroczko B, Visser PJ, Santana I, Svenningsson P, Blennow K, Aarsland D, Molinuevo JL, Zetterberg H, Mollenhauer B. Cerebrospinal fluid biomarkers in trials for Alzheimer and Parkinson diseases. Nat Rev Neurol. 2015;11:41–55. doi: 10.1038/nrneurol.2014.232. [DOI] [PubMed] [Google Scholar]
• 37.Polydoro M, de Calignon A, Suárez-Calvet M, Sanchez L, Kay KR, Nicholls SB, Roe AD, Pitstick R, Carlson GA, Gómez-Isla T, Spires-Jones TL, Hyman BT. Reversal of neurofibrillary tangles and tau-associated phenotype in the rTgTauEC model of early Alzheimer’s disease. J Neurosci. 2013;33:13300–11. doi: 10.1523/JNEUROSCI.0881-13.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 38.Santacruz K, Lewis J, Spires T, Paulson J, Kotilinek L, Ingelsson M, Guimaraes A, DeTure M, Ramsden M, McGowan E, Forster C, Yue M, Orne J, Janus C, Mariash A, Kuskowski M, Hyman B, Hutton M, Ashe KH. Tau suppression in a neurodegenerative mouse model improves memory function. Science. 2005;309:476–81. doi: 10.1126/science.1113694. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 39.Mallucci GR, White MD, Farmer M, Dickinson A, Khatun H, Powell AD, Brandner S, Jefferys JGR, Collinge J. Targeting cellular prion protein reverses early cognitive deficits and neurophysiological dysfunction in prion-infected mice. Neuron. 2007;53:325–35. doi: 10.1016/j.neuron.2007.01.005. [DOI] [PubMed] [Google Scholar]
• 40.Höglinger GU, Melhem NM, Dickson DW, Sleiman PMA, Wang L-S, Klei L, Rademakers R, de Silva R, Litvan I, Riley DE, van Swieten JC, Heutink P, Wszolek ZK, Uitti RJ, Vandrovcova J, Hurtig HI, Gross RG, Maetzler W, Goldwurm S, Tolosa E, Borroni B, Pastor P, Cantwell LB, Han MR, Dillman A, van der Brug MP, Gibbs JR, Cookson MR, Hernandez DG, Singleton AB, Farrer MJ, Yu C-E, Golbe LI, Revesz T, Hardy J, Lees AJ, Devlin B, Hakonarson H, Müller U, Schellenberg DG PSP Genetics Study Group. Identification of common variants influencing risk of the tauopathy progressive supranuclear palsy. Nat Genet. 2011;43:699–705. doi: 10.1038/ng.859. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 41.Boxer AL, Lang AE, Grossman M, Knopman DS, Miller BL, Schneider LS, Doody RS, Lees A, Golbe LI, Williams DR, Corvol JC, Ludolph A, Burn D, Lorenzl S, Litvan I, Roberson ED, Höglinger GU, Koestler M, Jack CR, Van Deerlin V, Randolph C, Lobach IV, Heuer HW, Gozes I, Parker L, Whitaker S, Hirman J, Stewart AJ, Gold M, Morimoto BH. AL-108-231 Investigators, Davunetide in patients with progressive supranuclear palsy: a randomised, double-blind, placebo-controlled phase 2/3 trial. Lancet Neurol. 2014;13:676–85. doi: 10.1016/S1474-4422(14)70088-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 42.Rojas JC, Boxer AL. Neurodegenerative disease in 2015: Targeting tauopathies for therapeutic translation. Nat Rev Neurol. 2016;12:74–6. doi: 10.1038/nrneurol.2016.5. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 43.Goedert M, Ghetti B, Spillantini MG. Frontotemporal dementia: implications for understanding Alzheimer disease. Cold Spring Harb Perspect Med. 2012;2:a006254. doi: 10.1101/cshperspect.a006254. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 44.Chien DT, Bahri S, Szardenings AK, Walsh JC, Mu F, Su MY, Shankle WR, Elizarov A, Kolb HC. Early clinical PET imaging results with the novel PHF-tau radioligand [F-18]-T807. J Alzheimers Dis. 2013;34:457–68. doi: 10.3233/JAD-122059. [DOI] [PubMed] [Google Scholar]
• 45.Santa-Maria I, Haggiagi A, Liu X, Wasserscheid J, Nelson PT, Dewar K, Clark LN, Crary JF. The MAPT H1 haplotype is associated with tangle-predominant dementia. Acta Neuropathol. 2012;124:693–704. doi: 10.1007/s00401-012-1017-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 46.Cruchaga C, Kauwe JSK, Harari O, Jin SC, Cai Y, Karch CM, Benitez BA, Jeng AT, Skorupa T, Carrell D, Bertelsen S, Bailey M, McKean D, Shulman JM, De Jager PL, Chibnik L, Bennett DA, Arnold SE, Harold D, Sims R, Gerrish A, Williams J, Van Deerlin VM, Lee VM-Y, Shaw LM, Trojanowski JQ, Haines JL, Mayeux R, Pericak-Vance MA, Farrer LA, Schellenberg GD, Peskind ER, Galasko D, Fagan AM, Holtzman DM, Morris JC, Goate AM GERAD Consortium, Alzheimer’s Disease Neuroimaging Initiative (ADNI), Alzheimer Disease Genetic Consortium (ADGC) GWAS of cerebrospinal fluid tau levels identifies risk variants for Alzheimer’s disease. Neuron. 2013;78:256–68. doi: 10.1016/j.neuron.2013.02.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 47.Desikan RS, Schork AJ, Wang Y, Witoelar A, Sharma M, McEvoy LK, Holland D, Brewer JB, Chen CH, Thompson WK, Harold D, Williams J, Owen MJ, O’Donovan MC, Pericak-Vance MA, Mayeux R, Haines JL, Farrer LA, Schellenberg GD, Heutink P, Singleton AB, Brice A, Wood NW, Hardy J, Martinez M, Choi SH, DeStefano A, Ikram MA, Bis JC, Smith A, Fitzpatrick AL, Launer L, van Duijn C, Seshadri S, Ulstein ID, Aarsland D, Fladby T, Djurovic S, Hyman BT, Snaedal J, Stefansson H, Stefansson K, Gasser T, Andreassen OA, Dale AM. ADNI, ADGC, GERAD, CHARGE and IPDGC Investigators, Genetic overlap between Alzheimer’s disease and Parkinson’s disease at the MAPT locus. Mol Psychiatry. 2015;20:1588–95. doi: 10.1038/mp.2015.6. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 48.Zhao Y, Tseng IC, Heyser CJ, Rockenstein E, Mante M, Adame A, Zheng Q, Huang T, Wang X, Arslan PE, Chakrabarty P, Wu C, Bu G, Mobley WC, Zhang YW, St George-Hyslop P, Masliah E, Fraser P, Xu H. Appoptosin-Mediated Caspase Cleavage of Tau Contributes to Progressive Supranuclear Palsy Pathogenesis. Neuron. 2015;87:963–75. doi: 10.1016/j.neuron.2015.08.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 49.Kondo A, Shahpasand K, Mannix R, Qiu J, Moncaster J, Chen CH, Yao Y, Lin YM, Driver JA, Sun Y, Wei S, Luo ML, Albayram O, Huang P, Rotenberg A, Ryo A, Goldstein LE, Pascual-Leone A, McKee AC, Meehan W, Zhou XZ, Lu KP. Antibody against early driver of neurodegeneration cis P-tau blocks brain injury and tauopathy. Nature. 2015;523:431–6. doi: 10.1038/nature14658. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 50.Roberson ED, Scearce-Levie K, Palop JJ, Yan F, Cheng IH, Wu T, Gerstein H, Yu GQ, Mucke L. Reducing endogenous tau ameliorates amyloid beta-induced deficits in an Alzheimer’s disease mouse model. Science. 2007;316:750–4. doi: 10.1126/science.1141736. [DOI] [PubMed] [Google Scholar]
• 51.Roberson ED, Halabisky B, Yoo JW, Yao J, Chin J, Yan F, Wu T, Hamto P, Devidze N, Yu GQ, Palop JJ, Noebels JL, Mucke L. Amyloid-β/Fyn-induced synaptic, network, and cognitive impairments depend on tau levels in multiple mouse models of Alzheimer’s disease. J Neurosci. 2011;31:700–11. doi: 10.1523/JNEUROSCI.4152-10.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 52.Vossel KA, Zhang K, Brodbeck J, Daub AC, Sharma P, Finkbeiner S, Cui B, Mucke L. Tau reduction prevents Abeta-induced defects in axonal transport. Science. 2010;330:198. doi: 10.1126/science.1194653. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 53.Leroy K, Ando K, Laporte V, Dedecker R, Suain V, Authelet M, Héraud C, Pierrot N, Yilmaz Z, Octave JN, Brion JP. Lack of tau proteins rescues neuronal cell death and decreases amyloidogenic processing of APP in APP/PS1 mice. Am J Pathol. 2012;181:1928–40. doi: 10.1016/j.ajpath.2012.08.012. [DOI] [PubMed] [Google Scholar]
• 54.Ittner LM, Ke YD, Delerue F, Bi M, Gladbach A, van Eersel J, Wölfing H, Chieng BC, Christie MJ, Napier IA, Eckert A, Staufenbiel M, Hardeman E, Götz J. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer’s disease mouse models. Cell. 2010;142:387–97. doi: 10.1016/j.cell.2010.06.036. [DOI] [PubMed] [Google Scholar]
• 55.Suberbielle E, Sanchez PE, Kravitz AV, Wang X, Ho K, Eilertson K, Devidze N, Kreitzer AC, Mucke L. Physiologic brain activity causes DNA double-strand breaks in neurons, with exacerbation by amyloid-β. Nat Neurosci. 2013;16:613–21. doi: 10.1038/nn.3356. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 56.van Hummel A, Bi M, Ippati S, van der Hoven J, Volkerling A, Lee WS, Tan DCS, Bongers A, Ittner A, Ke YD, Ittner LM. No Overt Deficits in Aged Tau-Deficient C57Bl/6.Mapttm1(EGFP)Kit GFP Knockin Mice. PLoS One. 2016;11:e0163236. doi: 10.1371/journal.pone.0163236. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 57.Passini MA, Bu J, Richards AM, Kinnecom C, Sardi SP, Stanek LM, Hua Y, Rigo F, Matson J, Hung G, Kaye EM, Shihabuddin LS, Krainer AR, Bennett CF, Cheng SH. Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy. Sci Transl Med. 2011;3:72ra18. doi: 10.1126/scitranslmed.3001777. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 58.Chiriboga CA, Swoboda KJ, Darras BT, Iannaccone ST, Montes J, De Vivo DC, Norris DA, Bennett CF, Bishop KM. Results from a phase 1 study of nusinersen (ISIS-SMN(Rx)) in children with spinal muscular atrophy. Neurology. 2016;86:890–7. doi: 10.1212/WNL.0000000000002445. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 59.DeVos SL, Miller TM. Antisense oligonucleotides: treating neurodegeneration at the level of RNA. Neurotherapeutics. 2013;10:486–97. doi: 10.1007/s13311-013-0194-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 60.McKay RA, Miraglia LJ, Cummins LL, Owens SR, Sasmor H, Dean NM. Characterization of a potent and specific class of antisense oligonucleotide inhibitor of human protein kinase C-alpha expression. J Biol Chem. 1999;274:1715–22. doi: 10.1074/jbc.274.3.1715. [DOI] [PubMed] [Google Scholar]
• 61.DeVos SL, Miller TM. Direct intraventricular delivery of drugs to the rodent central nervous system. J Vis Exp. 2013:e50326. doi: 10.3791/50326. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 62.Wegmann S, Maury EA, Kirk MJ, Saqran L, Roe A, DeVos SL, Nicholls S, Fan Z, Takeda S, Cagsal-Getkin O, William CM, Spires-Jones TL, Pitstick R, Carlson GA, Pooler AM, Hyman BT. Removing endogenous tau does not prevent tau propagation yet reduces its neurotoxicity. EMBO J. 2015;34:3028–41. doi: 10.15252/embj.201592748. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 63.Sanders DW, Kaufman SK, DeVos SL, Sharma AM, Mirbaha H, Li A, Barker SJ, Foley AC, Thorpe JR, Serpell LC, Miller TM, Grinberg LT, Seeley WW, Diamond MI. Distinct tau prion strains propagate in cells and mice and define different tauopathies. Neuron. 2014;82:1271–88. doi: 10.1016/j.neuron.2014.04.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 64.Takeda S, Wegmann S, Cho H, DeVos SL, Commins C, Roe AD, Nicholls SB, Carlson GA, Pitstick R, Nobuhara CK, Costantino I, Frosch MP, Müller DJ, Irimia D, Hyman BT. Neuronal uptake and propagation of a rare phosphorylated high-molecular-weight tau derived from Alzheimer’s disease brain. Nat Commun. 2015;6:8490. doi: 10.1038/ncomms9490. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 65.Takeda S, Commins C, DeVos SL, Nobuhara CK, Wegmann S, Roe AD, Costantino I, Fan Z, Nicholls SB, Sherman AE, Trisini Lipsanopoulos AT, Scherzer CR, Carlson GA, Pitstick R, Peskind ER, Raskind MA, Li G, Montine TJ, Frosch MP, Hyman BT. Seed-competent high-molecular-weight tau species accumulates in the cerebrospinal fluid of Alzheimer’s disease mouse model and human patients. Ann Neurol. 2016 doi: 10.1002/ana.24716. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 66.Deacon R. Assessing burrowing, nest construction, and hoarding in mice. J Vis Exp. 2012:e2607. doi: 10.3791/2607. [DOI] [PMC free article] [PubMed] [Google Scholar]

Supplementary Materials