F1000Research Article: Transient acid treatment cannot induce neonatal somatic cells to become pluripotent stem cells.

¹ Key Laboratory for Regeneration Medicine, School of Biomedical Sciences, Chinese University of Hong Kong, Shatin, Hong Kong
² Faculty of Life Sciences, University of Manchester, Manchester, M13 9PL, UK

Animals

Oct4-GFP transgenic (CBA-Tg (Pou5f1-EGFP) 2Mnn/j) mice, obtained from The Jackson Laboratory and maintained in the CUHK Laboratory Animal Services Centre, were used for experimentation. The usage of these mice was approved by the CUHK Animal Experimentation Ethics Committee (Project No.: 11/056/GRF-5). The new born neonates were kept in a nest bedding with their mothers at 25°C room temperature, under a 12/12 dark-light cycle, and sufficient food and water. We humanely euthanized six to seven of five-day-old neonatal Oct4-GFP mice by cervical dislocation (according to the ARRIVE guidelines, Kilkenny et al., 2012) and harvested their testes, spleens and lungs. This was done on the same day as the mice left animal breeding centre.

Germ cell isolation and analysis

Testes were harvested from five-day-old neonates and maintained in HBSS medium. The seminiferous tubules were immediately isolated from the testes, under a Nikon SMZ745T stereo dissecting microscope. The tubules were then kept, and maintained in DMEM medium supplemented with 10% qualified Fetal bovine serum (FBS) (Gibco^®, Invitrogen; Cat#10270) and penicillin (100U/mL)-streptomycin (0.1mg./mL) (Gibco^®, Invitrogen; Cat#15140122). The tubules were examined under a confocal microscope to determine whether the germ cells could express Oct4-GFP. Single germ cell suspensions were also produced from the seminiferous tubules using methods described by (Garcia & Hofmann, 2012). These germ cells were analyzed using a BD LSRFortessa^TM Cell Analyzer (BD Biosciences, USA) to determine whether these cells were capable of expressing Oct4-GFP.

Preparation of splenocytes and lung fibroblasts from neonatal mice

Spleens were isolated from five-day-old neonates capable of expressing Oct4-GFP when appropriately induced (e.g. using OSMK factors). The spleens were first mechanically passed through a cell strainer (grid size 70µm) to disperse the tissues and dissociate the splenocytes. The splenocytes were pelleted by centrifugation at 1200 rpm for five min and resuspended in ACK lysis buffer (65mM NH₄Cl, 10mM KHCO₃ and 0.1M Na₂-EDTA in distilled H₂O, adjusted to pH 7.3) for five min at room temperature to remove residual erythrocytes. The splenocytes were then resuspended in DMEM supplemented with 10% FBS, and 1% PS. The crude splenocytes were maintained at 37°C and 5% CO₂ for one to six days.

Besides splenocytes, we also isolated fibroblasts from the lungs of the Oct4-GFP neonates (Yau et al., 2011). Briefly, explants were prepared from dissected pieces of the lung (approximately 1 mm² in size). The explants were treated with 1 mg/ml collagenase Type I (Gibco^®, Invitrogen) for 30 min. The explants were then washed with PBS and plated onto collagen-coated 100 mm culture dishes (SPL; Cat#20101). DMEM/F12 plus 10% FBS were added to the explants (just enough to cover the explants). These explants were then maintained at 37°C and 5% CO₂, with the culture medium changed every three days. Fibroblasts could be observed migrating out of the explants after two days. After seven days, the explants were removed and the fibroblasts on the culture dishes were trypsinized with 0.25% Trypsin-EDTA (Gibco^®, Invitrogen) for two minutes and sub-cultured.

Isolation of CD45⁺ splenocytes

The crude splenocytes produced above were resuspended in PBS into a single-cell (1 × 10⁷ cells/ml) suspension. The cells were incubated with Anti-mouse CD45 antibodies, which were directly conjugated with FITC (1: 100 dilutions, BD Pharmingen^TM FITC Rat Anti-mouse CD45) for 30 min at 4°C. The stained cells were then washed three times with PBS and resuspended in PBS supplemented with 1% FBS. The CD45⁺-stained splenocytes were sorted and purified using a Cell Sorter (BD LSRFortessa Cell Analyzer). The cells were sorting on 3 different occasions using the same pool of splenocytes extracted from the spleens of 6 neonates.

Acid treatment of CD45⁺ splenocytes

We treated the somatic cells with low-pH medium according to the protocol described in (Obokata et al., 2014c). Accordingly, 5×10⁵ cells/ml of CD45⁺ splenocytes or lung fibroblasts were treated with low-pH HBSS (adjusted to pH 5.7 with HCl) for 25 min at 37°C. The acid-treated cells were then centrifuged at 1200 rpm for 5 min. The supernatants were removed and rechecked to confirm that the pH was still pH 5.7. All pH were measured using a calibrated pH meter (Mettler-Toledo, USA). All of acid-treated cell pellets were resuspended in DMEM/F-12 medium supplemented with 1× B27 and 1,000U LIF at a concentration of 1×10⁵ cells/ml. The cultures were then plated onto non-adhesive culture dishes (SPL; Cat#11035) and examined for GFP expression on seven consecutive days using microscopy (LEICA SP5). The experiments were performed in triplicate.

Real-Time quantitative PCR analysis

The acid-treated and untreated cells were harvested for qPCR after six-seven days of culture. Briefly, total RNAs were isolated using an RNeasy^® mini kit (Qiagen, USA) and reverse transcribed using an Omniscript RT Kit (Qiagen, USA). We used National Institutes of Health’s qPrimer Depot Database to determine the primers for Oct4 (forward: 5′GTTGGAGAAGGTGGAACCAA3′; reverse: 5′TCTTCTGCTTCAGCA GCTTG3′), Sox2 (Forward: 5′ACAAGAGAATTGGGAGGGGT3′; reverse: 5′AAAGCGTTAATTTGGATGGG3′) and Nanog (forward: 5′CCAGTGGAGT ATCCCAGCAT3′; reverse: 5′GAAGTTATGGAGCGGAG CAG3′) expressions. The master mix for each qPCR sample was prepared to a total volume of 5 µl for a 384 well-plate: 10 ng cDNA template, 0.55 µM forward primer, 0.55 µM reverse primer, SYBR green master premix (Takara Biotechnology Co Ltd, Dalian) and RNAse-free water (Ambion, Cat#AM9937). The qPCR was performed with a denaturation step at 95°C for 30 sec and thermal profiling (denaturation step: 95°C, 5 sec; annealing and extension steps: 42°C, 30 sec) for 40 cycles (ABI ViiA 7 Real Time PCR System). After the process was completed, the dissociation and amplification curves were checked to see if there was any abnormal amplification. The Ct values were further measured and acquired. The data were generated for quantitative analyses after normalization with GAPDH housekeeping gene. All samples were run in triplicate.

Statistics

The data were analyzed using two-tailed, paired student’s t-test. P<0.05 was considered to be statistically significant. The statistical analysis was performed using SPSS software version 22.

Validation of Oct4-GFP transgenic mice

We first confirmed that the cells in our Oct4-GFP transgenic mice were capable of expressing Oct4-GFP. It has been reported that all of the spermatogonia in the testes of this type of transgenic mice were capable of expressing Oct4 (Denn et al., 2008). Hence, we isolated the seminiferous tubules from the testes of our transgenic mice and directly examined the tubules under a confocal microscope. We determined that there were numerous Oct4-GFP⁺ spermatogonia present in the tubules (Figure 1A). This was further validated by flow cytometery of dissociated germ cells extracted from the seminiferous tubules (Figure 1B).

Effects of acid treatment on the neonatal Oct4-GFP splenocytes and lung fibroblasts

To replicate Obokata’s experiment, we isolated a pure population of CD45⁺ splenocytes from the spleens of five-day-old Oct4-GFP mice as shown in Figure 2A. The CD45⁺ splenocytes were treated with a mild acidic (pH 5.7) HBSS for 25 min at 37°C. The acid-bathed cells were then cultured in DMEM/F-12 medium supplemented with B27 and 1,000U LIF. We examined the cells for Oct4-GFP expression, every day for up to seven days, but did not observe any Oct4-GFP expression under the confocal microscope (Figures 2B, C and D). However, we did occasionally observe clusters of cells that appeared to be GFP⁺ but were later determined to be autofluorescence, as these cells were necrotic and stained positive with propidium iodide (Figure 2E). qPCR analysis was performed to establish whether the acid-bathed cells were capable of expressing the stemness markers. The qPCR results revealed that acid treatment did not induce the splenocytes to express Oct4, Sox2 and Nanog (Figure 2F).

We also attempted to produce STAP cells from Oct4-GFP lung fibroblasts. Like the splenocytes, the fibroblasts were treated with acidic HBSS (pH 5.7) for 25 min at 37°C. We checked the cells for GFP expression for seven consecutive days but did not observe any GFP expression (Figure 3A and B). Likewise, our qPCR analysis also did not show induced Oct4, Sox2 and Nanog expressions in our acid-treated fibroblasts (Figure 3C).

Author contributions

Mei Kuen Tang performed the confocal microscopy experiments, analysed the data and was overall in charge of the experiments performed in this study.

Lok Man Lo performed the experiments of the transgenic splenocytes.

Wen Ting Shi performed the experiments on the transgenic lung fibroblasts.

Yao Yao isolated the tissues from the transgenic mice and performed the flow cytometry experiments.

Henry Siu Sum Lee assisted in the production of the manuscript and figures.

Kenneth Ka Ho Lee wrote the manuscript.

Competing interests

No competing interests were disclosed.

Grant information

This research has been supported by the Hong Kong Cancer Fund (CUHK project number 6903321) assigned to Professor Kenneth Lee.

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Faculty Opinions recommended

References

Open Peer Review

Current Reviewer Status: ?

VERSION 1

PUBLISHED 08 May 2014

Reviewer Report 21 May 2014

Janet Rossant, Developmental and Stem Cell Biology, Hospital for Sick Children, Toronto, ON, Canada 

Approved

VIEWS 0

Reviewer Report 09 May 2014

Christine Mummery, Department of Anatomy and Embryology, Leiden University Medical Center, Leiden, The Netherlands 

Approved

VIEWS 0