CN100586476C - A kind of therapeutic vaccine of Myostatin specific antibody and preparation method thereof - Google Patents

本发明公开了一种Myostatin特异性抗体的治疗性疫苗及其的制备方法，利用人工合成DNA的方法获得了在N-端连接了Th细胞辅助表位TT_830-844人myostatin C-末端区基因片段，其基因序列为TT-Ms，将合成的TT-Ms基因片段克隆至pQE30原核表达载体，构建了pQE-TT-Ms重组表达载体，利用PCR扩增Ms基因片段，构建了pQE-Ms重组表达载体；在大肠杆菌中表达了融合蛋白His-TT-Ms和His-Ms，对蛋白进行鉴定后作为myostatin的蛋白疫苗；将合成的TT-Ms基因片段克隆至pVAC1-cms基因疫苗专用质粒，构建了pVAC-TT-Ms重组质粒，体外进行了目的蛋白表达的鉴定，作为myostatin基因疫苗。本发明的方法所构建的Myostatin蛋白疫苗和基因疫苗，免疫健康成年BALB/c小鼠，可诱导出针对人myostatin分子的特异性抗体，免疫小鼠骨骼肌质量和力量明显提高。The invention discloses a therapeutic vaccine of Myostatin specific antibody and its preparation method. The human myostatin C-terminal region gene of TT _830-844 human myostatin C-terminal region is obtained by using the method of artificial DNA synthesis. fragment, whose gene sequence is TT-Ms, the synthetic TT-Ms gene fragment was cloned into the pQE30 prokaryotic expression vector, the pQE-TT-Ms recombinant expression vector was constructed, and the Ms gene fragment was amplified by PCR to construct the pQE-Ms recombinant expression vector Expression vector; the fusion proteins His-TT-Ms and His-Ms were expressed in Escherichia coli, and the protein was identified as a protein vaccine for myostatin; the synthetic TT-Ms gene fragment was cloned into the pVAC1-cms gene vaccine-specific plasmid, The pVAC-TT-Ms recombinant plasmid was constructed, and the expression of the target protein was identified in vitro as a myostatin gene vaccine. The Myostatin protein vaccine and gene vaccine constructed by the method of the present invention can induce specific antibodies against human myostatin molecules by immunizing healthy adult BALB/c mice, and the skeletal muscle mass and strength of the immunized mice are obviously improved.

Therapeutic vaccine of a kind of Myostatin specific antibody and preparation method thereof

Technical field

The invention belongs to the medical biotechnology field, relate to that gene is synthetic, structure, the animal immune experiment of protein vaccine and gene vaccine, induce technology such as sero-fast vitro detection, therapeutic vaccine of particularly a kind of Myostatin specific antibody and preparation method thereof.

Background technology

Formation and the growth course that (myogenesis) refers to muscular tissue in the ontogenetic process takes place in muscle.The research that muscle takes place mainly comprises the growth of the formation of muscular tissue and Regulation Mechanism, muscular tissue and governing factor etc.The significance that research takes place muscle is: it is one of hot fields of developmental biology research that muscle takes place always, Skeletal Muscle Cell can be induced differentiation under condition of in vitro culture, there are objective morphology and molecular marker to distinguish simultaneously and breed or the own Skeletal Muscle Cell that breaks up, so the Regulation Mechanism research to the Skeletal Muscle Cell proliferation and differentiation is very important, for the differentiation mechanism research of muscle progenitor cell in the fetal development provides foundation; Muscle development and many muscle relevant diseases such as muscular dystrophy (MD), disuse muscle atrophy, tumor dyscrasia etc. are closely related, and research muscle can be pathogenesis research of muscle relevant disease and the diagnosis of muscle relevant disease, treats and provide fundamental basis; The research muscle development provides theoretical foundation for the animal breeding of animal husbandry meat.

1 Myostatin molecule and the active correlational study that suppresses

1.1 the discovery of Myostatin gene

The Myostatin structure has the total typical characteristic of TGF-beta superfamily: 1. N-holds hydrophobic signal peptide sequence, but nationality plays secretion signal to cross over endoplasmic reticulum; 2. propetide has a glycosylation site; 3. be close to biologically active zone and form a protease processing site by 4 aminoacid (RSRR); 4. the C-end comprises the biologically active zone of 9 conservative cysteine, forms dimer by intermolecular disulfide bond.But myostatin and other members' of TGF-'beta ' family homology very low (being up to 45%) proves the newcomer of TGF-beta superfamily, does not belong to the subfamily of having found.Yet, the C-end regions, the member of myostatin sequence and other TGF-beta superfamilies has high homology, and its height correlation Protein G DF-11 also has this characteristic, the two has constituted the family of a uniqueness in the TGF-beta superfamily.

1.2 Myostatin gene structure and hereditary effect.

1.3 the homology analysis of Myostatin gene

McPherron etc. ^[1]The C-end cDNA conservative with mice is the skeletal muscle cDNA library of probe screening different plant species, the cDNA sequence of having cloned rat, people, pig, cattle, sheep, chicken, turkey, baboon and Brachydanio rerio.Sequence analysis shows, the C-end mature peptide myostatin sequence homology of mice, rat, people, pig, chicken and turkey is 100%, baboon, cattle and sheep more only have the difference of 1～3 base, the homology of Brachydanio rerio and above-mentioned other animals is 88%, show myostatin sequence high conservative between different genera, may to have similar function between different genera relevant with myostatin albumen.

1.4 Myostatin gene expression and regulation

The in situ hybridization analysis finds that the myostatin gene all has expression in the embryo development procedure and the individual skeletal muscle of growing up.Early stage at fetal development, this expression of gene is confined to grow the muscle segment district of body segment, all expresses in the individual nearly all skeletal muscle of growing up.Utilize RT-PCR, Western-blotting technical research to show, myostatin also can detect its expression in the heart of period of embryo and adult, this albumen is present in the thin of cardiac muscular tissue and agree in Ye Shi fiber and the myocardial cell, myostatin up-regulated when myocardial infarction takes place, prompting myostatin tool in heart diseases such as the growth promoter of cardiac muscle and coronary heart disease has certain effect.Confirmation myostatin genes such as Ji also have a small amount of expression at animal adipose tissue, brain, tongue, the heart, lung, spleen, small intestinal, kidney, liver and bone marrow, and the expression of myostatin mRNA is also arranged in mammary gland.Show that the myostatin gene except that formation of regulation and control skeletal muscle and growth, also influences the growth and the differentiation of other protein involveds.

Ma etc. have cloned people myostatin gene and have comprised that 5 ' holds the total length 3.3kb fragment of regulatory region, find that the myostatin promoter sequence contains the growth response element to multiple material, comprise response elements such as glucocorticoid, androgen, thyroxin, MDF-1, MEF-2, NF-kB, and in external discovery, dexamethasone not only can strengthen the transcriptional activity of myostatin promoter in a kind of dose-dependent mode, and can strengthen endogenous myostatin expression of gene.Lang etc. have proved that the rising of myostatin in the body is relevant with IGF-I, II expression reduction, and the expression of myostatin is subjected to the just regulation and control that glucocorticoid raises under the stress state.Growth hormone (GH) has inhibitory action to myostatin, and Skeletal Muscle Cell is after adding GH, and myostatin expresses reduction.The GH receptor antagonist helps the myostatin up-regulated.

The expression of Myostatin is also closely related with the suffered load of muscle.The weight of muscle significantly descended after male adult rat carried out 17 days simulation spaceflights, and the muscle myostatin mRNA and the protein level of biceps femoris, quadriceps femoris, gastrocnemius are significantly higher than matched group simultaneously.Adult male bed 25 days is accompanied by the decline of lean body mass, muscle quantities, and blood myostatin concentration is higher than basic value 12%.Female Wistar rats is suspended in midair through 10 days hind legs, and sole of the foot flesh muscle weight in wet base descends 16%, and myostatin mRNA raises 110% simultaneously, and its protein level rises 37%.Above result shows under the situation that the muscle load reduces as aviation flight, bed, hind leg suspention etc., the decline of muscle quantities and myostatin mRNA and proteic level rising positive correlation, and training can reduce the expression of myostatin in the humans and animals body, improves muscle quality.

The human research finds that the myostatin level raises with advancing age, and middle age is than youngster height, and is the highest in 76～92 years old old women, and the content and the fat free body weight of serum myostatin are inversely proportional to; Be subjected to HIV to infect patient and healthy physiognomy ratio that muscle weight descends, the immunocompetence of myostatin all increases in its blood, the skeletal muscle, illustrate that myostatin is the attenuator of adult's Skeletal Muscle Growth, be the cause of disease that hiv infected patient skeletal muscle is become thin, will help to prevent and treat owing to human body increases the diseases such as amyotrophy that cause in age, AIDS to its further investigation.

1.5 the biological function of Myostatin

1.5.1 Myostatin is to the regulation and control of skeletal muscle

Studies show that myostatin C-stub area has important effect to the stability of its function, the inhibition zone is between aminoacid 42～115.Utilize gene knockout technology (knock-out) to make GDF-8 gene C-end biological activity zone disappearance of mice, obtain deficiency sudden change homozygote mice, this mice can normally survive and can procreate.Detect mice that its body weight finds homozygous mutation than the mice of heterozygote or wild type heavily about 30% (irrelevant) with sex, age.The muscle of sudden change homozygote mice shoulder and buttocks is obviously loose, remove skeletal muscle that skin finds whole health all than big many of the mice of wild type, the weight of monolithic muscle is about 2～3 times of wild-type mice, and fat weight does not have too big variation, so the increase of skeletal muscle weight is the main cause that causes the mutant mice weight increase.Further detect and find that the myofibrillar number of saltant mice skeletal has more 86% than wild-type mice, dna content exceeds 50% approximately, the hypertrophy (hyperplasia) that this shows the existing myocyte of reason of saltant mouse muscle hypertrophy also has myofibrillar hypertrophy (hypertrophy).

Research to people myostatin gene shows that also this gene is relevant with the muscle growth growth.The myostatin expression of gene is higher than the normal person in HIV infects the patient of caused skeletal muscle atrophy, prompting myostatin abnormal gene expression may with some amyotrophic lateral sclerosis disease association.Schuelke etc. have reported 1 routine myostatin gene noncoding region g.IVS1+5 site homozygosity G → A sudden change and the heritability muscle hypertrophy child that causes this gene inactivation, thereby have confirmed that myostatin is regulating the developmental important function of human body Skeletal Muscle Growth.

1.5.2 Myostatin is to the influence of lipidosis

Myostatin gene delection also plays inhibitory action to lipidosis except influencing the skeletal muscle growth.Alexandra etc. ^[23]Experimental results show that, myostatin gene mutation homozygote mice and matched group are than the fatty minimizing 70% of average body, and therefore, one of reason that sudden change homozygote mice body weight raises is that lipidosis reduces, possible mechanism is that myostatin directly acts on fatty tissue, regulates its metabolic process; Another kind may be that the myostatin that the myostatin signal lacks in the remote-effects fatty tissue in the skeletal muscle suddenlys change, thereby influences lipid metabolism.Ji etc. compare myostatin knock out mice and wild type and also draw similar conclusion, and myostatin knocks out the Mus fat mass to be reduced, and leptin (Leptin) secretory volume also correspondingly reduces.

Myostatin is the excretory a kind of functional sugar albumen of Skeletal Muscle Cell, and it may take autocrine, paracrine, endocrine mode to bring into play the function of control Skeletal Muscle Growth.At present, how myostatin being controlled lipometabolic mechanism knows little about it.Recent a research report says that myostatin can be in the external differentiation that causes adipose cell (adipocytes).If myostatin also can directly act on adipose cell in vivo, it can play a role by system or original place so, and known myostatin mRNA has expression at fat, although its expression is than low slightly in skeletal muscle.Maybe may be that the mutation effect of myostatin is the indirect effect that the myostatin signal lacks in the skeletal muscle in the fatty tissue.For example, skeletal muscle tissue myostatin sudden change can change energy metabolism, to prevent the accumulation of body fat.Also have one may be that muscle lacks the secondary messager that the myostatin signal can influence hypothesis.They are discharged by muscle, act on fatty tissue.Still can not get rid of myostatin and act on the probability that other tissue such as CNS regulate fatty tissue by direct and indirect mode.Though the mice that an evidence of indirect mode is other heredity to change also has similar fatty build-up effect when muscle increases.For example, overexpression IGF-I or ski transgenic mice in fact all lack fat in the skeletal muscle.The muscle specificity knocks out the insulin receptor gene mice to be reduced with muscle quantities, can see adverse effect, i.e. fat accumulation increases.

Thoroughly set forth myostatin and regulate lipid metabolism mechanism in vivo and need analyze genetic manipulation animal (genetically), their myostatin signal pathway composition in skeletal muscle or fatty tissue by specificity ground tissue.External myostatin is combined with Act RIIA and Act RIIB, compare with the myostatin knock-out mice, express the negative form (adominant negative form) of Act RIIB dominance in the skeletal muscle, transgenic mice skeletal muscle sharply increases, preliminary analysis finds that the fat accumulation of these transgenic mices also descends, and this and myostatin match to the indirect action of fatty tissue.Be difficult to these data are made an explanation, although because skeletal muscle specificity myosin light chain promotes son/enhancer (promoter/enhancer) to can be used to drive the expression of mutant receptors, transgene expression also can detect in fatty tissue.Though the transgene expression level of fatty tissue is than much lower in the skeletal muscle, this low expression level may be to stoping the myostatin signal in the fat enough.

1.6 the mechanism of action of Myostatin

Muscle growth is the result of a series of complex processes, comprises expression that muscle generates transcription factor with active, the sarcoplast cell cycle withdraw from (withdrawal), the fusion of sarcoplast in myotube and the acquisition of an anti-apoptosis phenotype.Myostatin is brought into play function by the propagation that suppresses the muscle precursor, be likely by the differentiation of autocrine mechanism regulating muscle generative nature, and granulation promoting element (myogenin) is its important effective object.

1.6.1 Myostatin biological activity forming process

The TGF-beta superfamily member is synthetic with the form of precursor protein (precursor proteins) earlier, subsequently, after restriction enzyme site is processed in the mode of hydrolysis, becomes bioactive mature peptide and enters blood circulation.The cattle sarcoplast extract Western engram analysis of cultivating shows, the myostatin specific antibody has detected the existence and LAP (the latency-associated peptide of myostatin propetide (52kDa), 40kDa) form, this experiment obviously shows, myostatin synthetic and hydrolysis processing in sarcoplast really.According to TGF-β Proteolytic enzyme processing mechanism and the primary structure feature reported, the processing site of myostatin may just occur in the conservative RSRR residue.

1.6.2 Myostatin is to the regulation and control in sarcoplast cycle

The TGF-beta superfamily member is inhibited to the G1 phase in many mammalian cells cycle.This " stagnation " that occurs in a certain stage of cell cycle (arrest) it is believed that with cell cycle in many factor-related.Myostatin mainly brings into play inhibit feature in the G1 phase of sarcoplast growth, suppresses cell and enters the S phase.In addition, myostatin also influences sarcoplast and enters into the M phase from the G2 phase.And this process of inhibition is seemingly specific, because in similar test, the sudden change reorganization that the Pierre covers special cattle myostatin allele gene does not have similar inhibition behavior.In addition, cell culture test shows, the inhibitory action of myostatin can reverse after from cultivating system it being removed.As if the relevant cell growth property " stagnation " of Myostatin just by p21 specificity takes place regulates, because in the sarcoplast that myostatin handles, have only the level of p21 just to be regulated and control.In addition, p21 expresses increase, and slightly decline is relevant with the Cdk2 protein expression, and this is correlated with will further increase p21 and Cdk2 ratio, thereby causes the active reduction of Cdk2.Therefore, myostatin negative regulation cell cycle enters into the S phase from the G1 phase, has kept the quiescent condition of satellite cell.

1.6.3 the signal transduction path of Myostatin

The signal conduction of TGF-beta superfamily is the heterodimer complex by I type (T β RI) and II type (T β RII) receptor.The heterodimer of being made up of I type and II type serine/threonine phosphorylating kinase receptor homodimer in the signal conduction is compound-mediated.Smads is a TGF-signal beta transduction molecule in the Cytoplasm, can directly combine with DNA, and they can be with the TGF-signal beta directly by in the cell membrane transfered cell nuclear.Myostatin suppresses activity and the expression of MyoD just to the inhibition of sarcoplast differentiation by Smad3, make sarcoplast can not be differentiated to form myotube.Its mechanism is that the cysteine dimer of myostatin C-end combines with II type Ser/Thr protein kinase receptor (ActR IIB) earlier, and then combine with I type Ser/Thr protein kinase receptor (ActR IB), form an allos polymer at cell surface, by the kinase activity of II receptor, cause the phosphorylation in I receptor GS territory.Activatory I receptor can with temporary transient combination of MH2 of Smad2 in the endochylema and Smad3 molecule, and make the serine residue phosphorylation in C end SSXS district and activate.Smad4 with no phosphoric acid site forms polymer then, enter into nucleus, the phosphorylation of the serine/threonine residue of MyoD is obstructed, having blocked basic region combines with the E-box of sarcoplast control region, interference has active MyoD-E-box synthetic protein to form, thereby be suppressed to the myocyte to myocyte's differentiation and formation myotube, hindered the formation of muscle.

1.7 the progress of blocking-up myostatin function

Utilize the gene knockout technology, the mouse muscle fiber of gene targeting myostatin has tangible hypertrophy and increases slightly, and fat content obviously reduces with the growth at age.Except gene targeting, scientists proposes a kind of new technical thought, think it unnecessary to remove the myostatin gene, as long as with a kind of method it being carried out function disturbs, just can obtain good result, its imagination is: C-terminal is the dimer that connects by disulfide bond, has only two molecules just biologically active that links together.C-terminal dimer and other protein comprise its propetide in conjunction with constituting nonactive complex, the propetide that is similar to the TGF-'beta ' family in vivo with the effect of vitro inhibition TGF-β.If use transgene method, produce in animal body and a kind ofly can disturb the active protein of dimer, there is the myostatin dimer of physiologically active to reduce, it is better that muscle will be grown.For this reason, they have produced the transgenic mice of myostatin propetide overexpression according to this imagination, and mouse muscle development condition and health are observed and analyzed.These propetides combine with the C-end dimer of myostatin, formation does not have active polymer, can receive good effect yet, the transgenic mice weight increase 20%～110% of this myostatin precursor protein overexpression, other economic characters are interference-free, and mice can normally breed.

By contrast, the experimental result of U.S. John Hopkins University is better.They produce a kind of albumen that is follistatin with a kind of transgenic mice, this albumen can stop combining of myostatin and myocyte's receptor, thereby stop its restriction to muscle development, the muscle of this transgenic mice is 1～3 times of non-transgenic mice, the effect highly significant.Simultaneously, they also have a kind of imagination, have destroyed the bonded receptor with myostatin, so they have produced the transgenic mice of a kind of Act RIIB non-active structure territory albumen overexpression, the result receives good effect equally, and the weight ratio control mice of transgenic mice weighs 125%.Zhu etc. produce the transgenic mice of the proteolytic cleavage machining position point mutation of a kind of myostatin, because myostatin precursor site is cut, to discharge the bioactive peptide dimer, this albumen processing site mutation causes the dimeric generation obstacle of bioactive peptide, receives that equally mice weight increases the result of (20%-35%).

As if experiment in vitro confirms that the same C-that participates in adjusting myostatin of FLRG and GASP-1 holds dimeric activity.FLRG and GASP-1 combine with the myostatin in the blood in people and mice, show with the result of recombiant protein research, and these two kinds of albumen can both be with the C-end dimer combination of high-affinity with myostatin, and suppress its activity.What is interesting is that under the non-existent situation of C-end dimer, GASP-1 can directly combine with propetide.So far, still not about these molecules genetic information of biological function in vivo.

Another kind is exactly a myostatin antibody at the bioactive way of anti-myostatin directly.Immunity such as Whittemore have prepared the antibody of anti-myostatin, and handle the effect that adult mice is regulated adults muscle with checking myostatin with its, the result shows that the mice skeletal quantity with the myostatin antibody treatment of pharmacology dosage increases, and grip strengthens.This research has shown that first myostatin generates negative growth factor as skeletal muscle postnatal animal is worked, and prompting myostatin inhibitor can be used for clinical skeletal muscle growth inhibition treatment of diseases.In a word, blocking-up myostatin signal transduction path may be to increase the useful preparation of animal muscle growth, and is very meaningful in the treatment and the application in the agricultural of human muscle relevant disease.

1.8 Myostatin and muscle are diseases related

Myostatin as the muscle growth development inhibitor may with muscle diseases related have directly get in touch.Gonzalez-Cadavid etc. at first prove at HIV and infect to occur in cachectic patient bone flesh and the serum, and the myostatin expression is apparently higher than healthy people, have illustrated that the amyotrophy due to people's wasting diseases is relevant with the unconventionality expression of myostatin.Yarasheski etc. have studied the amyotrophy that shows with age growth in the normal population, and also the rising of myostatin is relevant in serum.Utilizations such as Zimmers can be handled the myostatin gene and circulate in vivo and express the animal model increase and confirm that high expressed myostatin albumen can bring out cachexia performances such as obviously becoming thin appears in animal, amyotrophy, eye socket depression in the body circulation.Discoveries such as Yamanouchi also have the expression of myostatin in the fibroblast of some infiltration wounds, think it may is because the inflammatory process that takes place at the anathrepsis commitment causes, and newborn skeletal muscle myostatin gene expression dose descends.Reardon etc. experiment showed, that myostatin is the secondary myofibrillar amyotrophy factor.Krik etc. find that by control experiment myostatin content is extremely low, illustrates that myostatin plays the negative regulation effect to anathrepsis in regenerated myotube part.

The pathology generation of myostatin participation muscular dystrophy that nearest research report is certain, (Duchennemuscular dystrophy DMD) blocks the amyotrophy symptom that the proteic expression of myostatin can be alleviated the mdx mice in the phenotype mice at mdx.Bogdanovich etc. utilize homemade mice myostatin protein antibodies treatment Du Shi muscular dystrophy model mice (DMD), and the treatment group is compared than control group mice, muscle quality, and muscular tension intensity obviously strengthens, and ill treatment mice symptom is obviously improved.Wagner etc. utilize the egg homozygote mice certainly and the mdx mice hybridization with DMD and BMD (Becker muscular dystrophy) phenotype of myostatin gene mutation, the mdx mice of screening myostatin sudden change in the offspring, these mices are strongr and be rich in muscle than mdx mice, show that blocking-up myostatin gene expression may alleviate muscular dystrophy patient's amyotrophy phenotype.The Myostatin antagonist can also be used to treating rhabdomyosarcoma.Experiments such as Sharma show that when myocardial infarction, the myocardial cell myostatin up-regulated around damaged part infers that myostatin plays an important role at myocardium pathology and physiological process mid-term.2004, Schuelke etc. have reported that 1 example causes the heritability muscle hypertrophy child case of gene inactivation, thereby confirmed the important function of myostatin in the human muscle cell adjusting and controlling growth because of myostatin gene noncoding region g.IVS1+5 site homozygosity G → A sudden change.

Discover myostatin gene delection mice (Mstn ^-/-Mice) not only show as muscle hypertrophy, hypertrophy but also follow athero to reduce.Confirm with fat and two kinds of model mices of diabetes subsequently, can effectively suppress athero and carbohydrate metabolism disturbance after the myostatin gene delection, provide new drug target for treating obesity and type ii diabetes.

2 therapeutic vaccines

1902, Wright was with heat-killed staphylococcus aureus vaccine therapy recurrent disease, and proposed the vaccine therapy theory and become the founder of modern vaccination therapy.Therapeutic vaccine (TherapeuticVaccine) is meant could break immunologic tolerance in chronic infection person's body! The new generation vaccine that reconstruction or enhance immunity are replied.Therapeutic vaccine can be eliminated pathogen or abnormal cell in diseased individuals inducing specific immunne response, and disease is treated, and is the new treatment means of antiviral, antineoplastic.Be mainly used in the disease of still not having effective medicine at present, as: chronic viral infection, allergy, tumor, Alzheimer thatch disease, diabetes, hypertension, obesity and rheumatic arthritis etc.Therapeutic vaccine as a kind of novel be the vaccine of purpose with the treatment, be a kind of supplementary means that improves the immunne response ability in the infectious disease comprehensive therapy, compare with preventative vaccine, the development of therapeutic vaccine will be many slowly.But monoclonal antibody is obtained immense success aspect the treatment disease, is indicating that the therapeutic vaccine that can induce antibody to produce in vivo has vast potential for future development.

2.1 the basic feature of therapeutic vaccine

Therapeutic vaccine as a kind of novel be the vaccine of main purpose with the treatment, all embody aspect mentality of designing, preparation means and the application technology diversification, stage construction and with modern molecular biology and the married characteristics of cytologic technology, the preventative vaccine that its complexity is traditional head and shoulders above.The application of therapeutic vaccine then is the individuality of the persistent infection of infective virus microorganism, use the use comparatively strict, that selection should be arranged, the vaccine composition can be done various combinations as required, be intended to break the immunologic tolerance of body, improve the immunne response of body, belong to the immunization therapy category, may certain side effect be arranged with immunologic injury.Yet diseases such as present many infectious disease, tumor still do not have effective medicine, and by contrast, the side effect of therapeutic vaccine is much smaller more than medicine.Therapeutic vaccine is as a kind of supplementary means that improves immunity in the infectious disease Comprehensive Treatment in addition, to some some disease of the mankind of still not having effective treatment means so far, has certain therapeutical effect as hepatitis B, leprosy, leishmaniasis bacterium, brucellosis etc.

Animal experiment shows and can treat following disease by producing high titre antibody in the inductor: induce the neutrality antibody of TNF-alpha specific by active immunity, can treat the joint of animal inflammation; Vaccine at angiotensin can be treated hypertension; Can treat Eosinophilia's disease that pathogen causes at the vaccine of IL-9; Vaccine at IL-5 can be treated asthma; Vaccine at N-methyl-D-aspartate receptor-1 (NMDAR1) can be treated apoplexy.In addition, at some gonadal hormone such as human chorionic gonadotropin (human chorionic gonadotro-pin, immunity HCG) can reduce the intravital hormonal readiness of women and reach contraceptive effect; Can treat prostate patient in late period at the vaccine of gonadotropin-releasing hormone (GnRH); Among the cancer of pancreas patient, the antibody that utilizes therapeutic vaccine to induce at gastrin (gastrin) can prolong patient's life late.

2.2 the classification of therapeutic vaccine

Therapeutic vaccine mainly is divided into following three classes by composition:

2.2.1 the compound reorganization therapeutic vaccine of protein

The structure of therapeutic vaccine target antigen or combination need the close target antigen that differs from traditional vaccine that has again, can arouse the functional immunity of sickened body and reply.Facts have proved and to transform in the face of protein vaccine from the three parts: modify at protein level, as lipoproteinization; In combination, carry out the compound of polyprotein and polypeptide coupling; On structure or configuration, transformed, as immobilization, crosslinked, the outer apparent conformation qualification etc. that reaches of structure.

As ideal immunogen; can comprise purpose antigen B cell epitope and self or external source t cell epitope in the antigen molecule simultaneously; can induce the body fluid or the cell immune response of out-degree high specific; play prevention or therapeutical effect from humoral immunization and cellular immune level, therefore can give wider protectiveness.But be hidden in the immunogenicity of the epi-position enhancement antigen of antigen molecule inside by design, general DR helper T cell epitope (pan-DR helper T cell epitopes, PADRE) or Universal T-cell epitopes (universal T epitope) combine with the common human leukocyte antigen-DR of crowd (HLA-DR) molecule with high-affinity, the less MHC of being subjected to limits.The key of preparation epiposition vaccine is to determine the specific polypeptide that can be discerned by immunocyte.Therefore the evaluation of epi-position is the first step that makes up epiposition vaccine.Identify that epi-position method commonly used has: 1. enzymatic isolation method; 2. use phage show peptide storehouse technology screening mimic epitope; 3. elution method: epi-position is eluted from MHC molecule or monoclonal antibody, check order; 4. synthetic overlapping peptide method; 5. use the computer software analysis whole genome, candidate's epitope peptide that prediction obtains is verified with experimental technique again, can identify epitope fast and accurately.Because the epitope polypeptide molecular weight is little, easily by intracellular proteasome degradation, can strengthen its immunogenicity by the whole bag of tricks.With B cell epitope and carrier protein such as bovine serum albumin (bovine serus albumin; BSA) or keyhole limpet hemocyanin (keyhole limpet hemocyanin; KLH) or phase coupling such as tetanus toxoid, the protection that is produced can be compared with macromole antigen.

In the malaria vaccine development; Birkett etc. are with the B cell epitope of multiple circumsporozoite protein and the t cell epitope immune human body in reorganization back of connecting with hepatitis B virus surface antigen or cAg; but excitating organism produces high-level antibody and Th1 type cellullar immunologic response, and behind the suitable adjuvant immunity human body Plasmodium falciparum challenge infection has been produced 50% protection.

2.2.2 cell vaccine

With the cell is that the vaccine of forming mainly contains tumor cell and dendritic cell (DC) vaccine.Can strengthen its immunogenicity with various accessory molecules modification tumor cells or DC, reach the purpose of treatment.Dendritic cell is the strongest antigen presenting cell of function in the body, can synthesize a large amount of MHC II quasi-molecules; Have picked-up and transport antigenic special film receptor; Can effectively absorb and handle antigen and migrate to the T cell compartment then, have the process of a maturing; Can activate infantilism T cell forcefully, a spot of antigen and a spot of dendritic cell promptly are enough to activated T cell.

DC can induce very strong primary immune response, and other antigen presenting cells such as macrophage and B cell can only activate the T cell that has been subjected to antigenic stimulus.The principal mode of antitumor immunity of organism reaction is a cellular immunization, and excitating organism produces the effective antitumour cellullar immunologic response, is to improve the key of exempting from curative effect, and the core of effective antitumour cell immune response is to produce CD8 ⁺Cytotoxic T cell.Dendritic cell is generally by giant cell drink, receptor-mediated endocytosis and engulf 3 kinds of mode antigen uptaking, and can be directly to CD8 ⁺CTL offers antigen, starts the killing activity of CTL cell.

At present, the tumor of using dendritic cell feedback therapy for treating comprises multiple myeloma, melanoma, carcinoma of prostate and colorectal cancer etc., and clinical practice I, II phase test have obtained challenging result.

2.2.3 nucleic acid vaccine

Nucleic acid vaccine is a kind of new generation vaccine that enjoys people to pay close attention in recent years.Nucleic acid vaccine comprises dna vaccination and RNA vaccine, can be caused that by coding the genetic fragment and the vector construction of the pathogen antigen of protective immunological reaction forms.Dna vaccination can be absorbed by host cell after intramuscular injection or particle gun import body, enters in the nucleus of host cell and is transcribed into mRNA, translates into protein again in endochylema.Part protein combines with MHC I quasi-molecule after degraded, and the surface of being offered cell is by CD8 ⁺The receptor identification of T cell, and active cell poison T cell activity is killed and wounded target cell; And another part protein also can be secreted away, absorbed by antigen presenting cell as foreign protein again, in phagolysosome, be degraded into polypeptide, further combine with MHC II quasi-molecule, and offer cell surface by antigen presenting cell and discerned by the receptor of Th2 cell, cytokine by Th2 emiocytosis acts on the B cell then, and stimulates to produce the humoral immune reaction of antibody.

Compare with other vaccines, dna vaccination has many advantages: 1. offer the natural antigen form of immune system, do not have pathogen may duplicate and duplicate the morbific danger in back in vivo and do not have virulence reversion or sudden change.2. immunne response is comprehensive, can cause cellular immunization and humoral immunization simultaneously, and energy inducing cytotoxic T lymphocyte, thus infectious disease in the prevention cell.Researcher inserts vector plasmid with the DNA of encoding influenza virus A nucleoprotein, is injected in the Mus quadriceps femoris, successful production protectiveness CTL.Davis etc. also find, it is 100 times that the CTL of purification HBVenvAg immunity replys that the CTL of HBVenvAg genetic immunization replys.3. the single inoculation can be induced long-term or lifetime immunity.Davis etc. only inject a pin in the genetic immunization process.The good immunne response of 1 week back survey, and in 1 month, continue to raise, kept at least 17 months.4. produce easy rapidly, with low cost.5. need not cold preservation, be easy to storage and transport.6. be easy to carry out simultaneous inoculation, the possibility that designs new combined vaccine is provided at several antigen molecules of identical or different pathogen.7. nucleic acid vaccine can also improve baby's antibody response, promotes the elimination of intracellular antigen, prevents the inhibition of maternal antibody mediation.

Yet also there are a lot of weak points in dna vaccination: 1. stimulate a little less than the energy force rate natural infection of organism immune response.2. the expression of genes of interest is not ideal enough; 3. proteic expression can continue how long to remain further to study in the body, and the foreign aid DNA that 4. imports body has the potential danger of integration, and may cause the dysfunction of immune system itself after the dna immunization inoculation.Thereby further further investigation is carried out safety and long-term effect and is observed, and weighs the pros and cons of nucleic acid vaccine comprehensively, and its benefit of overall merit and danger are the new problems of current nucleic acid vaccine research.

Since nineteen ninety-five, the clinical trial of 6 kinds of people's dna vaccination has been ratified in audit of U.S. FDA biological product and research center, comprises the dna vaccination of acquired immune deficiency syndrome (AIDS), influenza, herpes simplex, hepatitis B, malaria and carcinoembryonic antigen.Because dna vaccination is a kind of new generation vaccine, present most of dna vaccinations are in the I clinical trial phase stage, and its main purpose is the safety and the immunogenicity of proof vaccine.The several years clinical observation does not find that as yet the dna molecular of vaccine can be incorporated in the chromosome or brings out the probability of autoimmune disease.It is encouraging that the malaria dna vaccination has entered the III clinical trial phase.

2.3 the mechanism of action of therapeutic vaccine

The therapeutic vaccine application is the individuality of infective virus, this moment, body was because of having the antigen of virus, but because immune response is partly low and shortcoming, can not support normal effect, therapeutic vaccine is offered immune system by different approaches with microbial antigen, remedy or the immune response of excitating organism (especially cytotoxicity, lymphocytic killing activity) thus reach the therapeutical effect of removing virus.Other has the scholar to think, behind receiving treatment property of the body vaccine, stimulates the T/B cell proliferation, and activating macrophage promotes NK cell killing tumor cell, thus performance potentiation.For example, bacillus calmette-guerin vaccine treatment tumor is treated tumor by the enhancing human body immunity system to the lethal effect of tumor cell exactly, makes patient's immune system to the aitiogenic while of new genetic recombinants, also repel and hit self similar cause of disease, thereby reach the effect of treatment.In addition, the mechanism of action of antigen-antibody complex type therapeutic vaccine may for: antibody to antigenic agglutination, form than macromole, easily engulfed and angtigen presentation; Antibody by the Fc receptors bind of Fc section and antigen presenting cell, has changed the process of angtigen presentation with after antigen combines, and more helps inducing antibody or CTL; Antigen-antibody complex can activate the release of multiple lymphokine, by the interaction between lymphokine, has more promoted antigenic offer and process and activate CTL or Th cell; The immunological network system can further play a role; Ag-Ab activating complement system helps the virus that cracking has or not film; Antigen-antibody complex itself can be used as adjuvant and strengthens immunogenicity of antigens.

In the immunoreation at exotic antigen, T cell and B cell are worked in coordination and could be produced antibody effectively: when being subjected to the exotic antigen immunity, specific B cell conjugated antigen produces initial activation signal.In addition, B cell endocytic antigen presents the complex of antigenic peptides and mhc class ii molecule on its surface.Usually, the B cell can not activate T _HCell.Activate T _HCell, dendritic cell is absolutely necessary, the dendritic cell antigen uptaking, and, activate T at the complex of its cell surface antigen-presenting peptide and MHC II quasi-molecule _HCell.T after the activation _HThe complex of antigenic peptides that cell recognition B cell surface presents and MHC II quasi-molecule causes other conversion of B cell proliferation, production of antibodies and antibody class.If lack T because of immunologic tolerance _HThe synergism of cell so just can not produce antibody.In design process at the vaccine of oneself protein, if autoantigen merged with foreign protein or peptide carrier or be coupled at, just might walk around the TH cell tolerance: the specific B cell of autoantigen just can absorb this autoantigen and coupled carrier protein, and present the complex of carrier peptides and MHC II quasi-molecule on its surface, because T _HCell does not have immunologic tolerance to carrier protein, thus can be activated, thus collaborative from the specific antibody of the B of antigenic specificity cell generation at autoantigen.

Compare with the T cell tolerance, it is much loose that Blymphocyte tolerance is wanted.In fact, in many cases, autospecific B cell occurs with normal frequency in vivo, if be subjected to antigen and T _HThe combined effect of cell will be activated ^[88]So to many solubility oneself proteins, have its specific b cells strain in the body, especially when this albumen is not very expression more than needed especially like this.For this albuminoid or polypeptide, it is linked to each other with carrier protein, walk around the T cell tolerance, just might produce effective vaccine.Utilize this strategy, induced antibody response at multiple self hormone.

Embrane-associated protein and can induce B cellular immunization incapability with the albumen that the multivalence form exists, promptly reactionless to antigenic stimulus under normal conditions, have in addition can cause specific b cells clone's rejecting.Though can not stimulate disallowable specific b cells clone, by suitable immunization strategy, B cellular immunization incapability might be broken.The antigen of high copy number can be crosslinked with B-cell receptor effectively, provides intensive activation to stimulate, thereby break Blymphocyte tolerance.Someone is verified inductive more much better than than monomer TNF-α with the inductive antibody response of virus-like particle (VLPs) link coupled multicopy TNF-α.It can be possible thereby break Blymphocyte tolerance by level identification that this explanation makes antigen.This method may solve the problem of utilizing adjuvant in addition, because do not having can to induce strong antibody response under the situation of adjuvant with the link coupled antigen of VLPs.Not only in the mice body, have the antigenicity of height with the link coupled antigen of VLPs, and in human body, also have the antigenicity of height.50 μ g and the link coupled polypeptide of VLPs or chemical substance are not having just can to induce stronger antibody response in human body under the situation of adjuvant.Because latter's cost is lower, patient is acceptant and produce good compliance.

At present, there are about 500 kinds of biological medicines carrying out clinical research, nearly 100 kinds of vaccines wherein arranged, mainly at tumor and infectious disease.Seldom a part has been represented the first generation of this series products at the therapeutic vaccine of chronic disease and drug addiction, a kind of therapeutic vaccine at Alzheimer thatch disease has begun clinical trial, also has many therapeutic vaccine preclinical tests at autoantigen to make good progress.

2.4 the improvement strategy of therapeutic vaccine

The immunity of vaccine and pathomechanism more complicated, as the activated immunoreation of therapeutic vaccine, cell is protective or pathologic still indeterminate etc., causes the effect of vaccine therapy very unstable, desirable, and is ripe not enough in actual applications.Therefore how to bring into play immunomodulating, how to suppress persistent virus infection etc., these problems are prerequisites of development therapeutic vaccine, when the design therapeutic vaccine, select which kind of dominant antigen, immunostimulation and immunosuppressant all should compare and weigh as technical problems such as adjuvants.

This shows, can develop therapeutic vaccine from following several respects: 1. select best antigen conformation to inoculate enhance immunity originality; 2. develop the recombinant antigen between different virus, the chimeric antigen that virus and cytokine merge, virus antigen modifications etc. are to induce efficient immune; 3. antigen is produced albumen with the recombinant immune response gene and inoculate, so that discerned rapidly by CD8 or CD4 surface positive cell; 4. increase immune cofactor and use novel adjuvant; 5. use novel immunological technique, as dna immunization technique, antigenized antibody etc.; 6. MHC I class or the mhc class ii protein gene of directly will encoding introduced body, makes antigen, cytokine and other immune response gene products express processing in vivo, offers to immune system in the best condition.

Summary of the invention

The objective of the invention is to, therapeutic vaccine of a kind of Myostatin specific antibody and preparation method thereof is provided, for the muscle treating correlative diseases provides new medicine.

To achieve these goals, the technical solution adopted in the present invention is: a kind of therapeutic vaccine of Myostatin specific antibody, utilize artificial-synthetic DNA's method to obtain to have connected the auxiliary epi-position TT of Th cell at the N-end _830-844People myostatin C-end region genetic fragment, its gene order is TI-Ms, corresponding amino acid sequence is specific as follows:

Gly?Ser?Gln?Tyr?Ile?Lys?Ala?Asn?Ser?Lys?Phe?Ile?Gly?Ile?Thr?Glu

1 5 10 15

Ala?Ala?Ala?Glu?Phe?Asp?Phe?Gly?Leu?Asp?Cys?Asp?Glu?His?Ser?Thr

20 25 30

Glu?Ser?Arg?Cys?Cys?Arg?Tyr?Pro?Leu?Thr?Val?Asp?Phe?Glu?Ala?Phe

35 40 45

Gly?Trp?Asp?Trp?Ile?Ile?Ala?Pro?Lys?Arg?Tyr?Lys?Ala?Asn?Tyr?Cys

50 55 60

Ser?Gly?Glu?Cys?Glu?Phe?Val?Phe?Leu?Gln?Lys?Tyr?Pro?His?Thr?His

65 70 75 80

Leu?Val?His?Gln?Ala?Asn?Pro?Arg?Gly?Ser?Ala?Gly?Pro?Cys?Cys?Thr

85 90 95

Pro?Thr?Lys?Met?Ser?Pro?Ile?Asn?Met?Leu?Tyr?Phe?Asn?Gly?Lys?Glu

100 105 110

Gln?Ile?Ile?Tyr?Gly?Lys?Ile?Pro?Ala?Met?Val?Val?Asp?Arg?Cys?Gly?Cys

115 120 125

Ser?***?Val?Asp

130

Synthetic TT-Ms gene fragment clone to the pQE30 prokaryotic expression carrier, is made up the pQE-TT-Ms recombinant expression carrier, utilize pcr amplification Ms genetic fragment, made up the pQE-Ms recombinant expression carrier; At expression in escherichia coli fusion rotein His-TT-Ms and His-Ms, albumen is identified that the back is as the protein vaccine of myostatin;

Synthetic TT-Ms gene fragment clone to the special-purpose plasmid of pVAC1-cms gene vaccine, has been made up the pVAC-TT-Ms recombiant plasmid, and the external evaluation of having carried out the destination protein expression is as the myostatin gene vaccine.

Myostatin protein vaccine and gene vaccine that method of the present invention is constructed have been selected the special-purpose plasmid pVAC1-cms of gene vaccine for use during gene vaccine, make up the plasmid pQE30 that protein vaccine has been selected amalgamation and expression 6His for use, to improve the immunogenicity of expressing protein.The immune health BALB/c mouse of growing up can induce the specific antibody at people myostatin molecule, and immune mouse skeletal muscle mass and strength obviously improve.

Description of drawings

Fig. 1 is His-Ms expression, purification and qualification result.Wherein, figure (A) is that His-Ms obviously expresses in escherichia coli, and figure (B) is Ni affinity chromatography column purification destination protein His-Ms, and purity is more than 90%.Figure (C) is that the His-Ms fusion rotein behind the purification carries out the immunoblotting evaluation, finds that newborn protein band can combine with anti-GDF-8 multi-resistance and anti-His monoclonal antibody generation specificity.

Fig. 2 is His-TT-Ms expression, purification and qualification result.Wherein, figure (A) is that His-TT-Ms obviously expresses in escherichia coli, and figure (B) is Ni affinity chromatography column purification destination protein His-TT-Ms, and purity is more than 90%.Figure (C) is that the His-TT-Ms fusion rotein behind the purification carries out the immunoblotting evaluation, finds that newborn protein band can combine with anti-GDF-8 multi-resistance and anti-His monoclonal antibody generation specificity.

Fig. 3 is pVAC-TT-Ms plasmid purification and vivoexpression testing result.Wherein, figure (A) result shows pVAC-cms plasmid OD ₂₆₀/ OD ₂₈₀Be 1.78 (1.25ug/ul), pVAC-TT-Ms plasmid OD ₂₆₀/ OD ₂₈₀Be 1.82 (1.32ug/ul), illustrate that plasmid does not contain foreign material such as protein substantially, electrophoretic analysis shows that plasmid superhelix, spiral and linear band are distinct.Figure (B) is the plasmid purification transfection CHO cell, and RT-PCR result detects genes of interest to be had significantly and transcribe; Figure (C) detects destination protein at eukaryotic cell expression for the cellular immunization groupization.

Fig. 4 detects the immune serum antibody titer with ELISA: pVAC-TT-Ms recombiant plasmid immune animal result shows, in every group of 6 mices measuring, has antibody to produce (figure A) after 4 immunity are arranged, and the average antibody titre is 2 * 10 ³More than (figure B).Myostatin protein vaccine immune animal result shows that in every group of 6 mices measuring, His-Ms organizes 2 * 10 ²Dilution factor has antibody response (figure C) after 2 mouse immunes are arranged, and the average antibody titre is 2 * 10 ²More than (figure E).And the His-TT-Ms group is 2 * 10 ²Dilution factor has antibody response after 3 immunity are arranged, 2 * 10 ³Dilution factor has antibody response (figure D) after 1 immunity is arranged, and the average antibody titre is 2 * 10 ³More than (figure E).

Fig. 5 is the body weight change (figure A) of myostatin dna gene vaccine mice and the body weight change (figure B) of protein vaccine immune mouse.

Fig. 6 is the variation of immune mouse muscle quality.The result shows, compare with the normal control group, insert gene vaccine pVAC-TT-Ms group and protein vaccine His-TT-Ms group mice quadriceps femoris, gastrocnemius and the significantly increase of pectoralis major weight of TT epi-position, and outside His-TT group mice pectoralis major weight and matched group be significantly increased, though all the other two kinds of muscular tissue quadriceps femoris and gastrocnemius weight have increase, do not have significance.The pVAC-TT-Ms dna gene vaccine slightly is better than the His-TT-Ms protein vaccine to the influence of mice quadriceps femoris, gastrocnemius and pectoralis major weight.There is not significant difference between each group of the average weight of immune mouse abdominal cavity free-fat tissue.

Fig. 7 is an immune mouse muscular tissue metamorphosis.The result shows that gene vaccine pVAC-TT-Ms immune mouse and protein vaccine His-TT-Ms immune mouse quadriceps femoris cell have loose phenomenon.

Fig. 8 is that immune mouse forelimb grip changes.The result shows, the grip that can obviously strengthen the mice forelimb at gene vaccine and the protein vaccine of myostatin, compare with the normal control group, pVAC organizes no significant change, gene vaccine pVAC-TT-Ms group mice forelimb grip has on average increased by 30.9%, protein vaccine His-Ms group and His-TT-Ms group have increased by 26.6% and 29.6% respectively, and the strength that can obviously improve animal muscle at the vaccine immunity animal of myostatin is described.

The present invention is described in further detail below in conjunction with drawings and Examples.

The specific embodiment

The present invention utilize synthetic gene the method synthetic myostatin C-end region (133 aminoacid) gene order, made up gene vaccine and two kinds of therapeutic vaccines of protein vaccine at myostatin.Immunologic tolerance and reinforcement vaccine immunogenicity in order to break the myostatin vaccine have inserted the general Th cell epitope TT that activates the Th cytosis that has that derives from tetanus toxin at its N-end when making up myostatin protein vaccine and gene vaccine _830-844, to strengthen the immune effect of two kinds of therapeutic vaccines of myostatin.Utilize the antigen presentation carrier to the immunogenic influence of antigen, selected for use the gene epidemic disease to reach proteic immunogenicity when making up gene vaccine.The immune health BALB/c mouse of growing up, can induce at the special-purpose plasmid pVAC1-cms of the special Seedling of people myostatin molecule, make up protein vaccine and selected the plasmid pQE30 of amalgamation and expression 6His for use, to improve table property antibody, immune mouse skeletal muscle mass and strength obviously improve.Particular content is:

1 synthetic TT-Ms gene order

Synthetic N-end inserts the people myostatin mature peptide C-terminal gene sequence (133aa) of TT epi-position, and synthetic gene order is abbreviated as TT-Ms, and the TT-Ms corresponding amino acid sequence is specific as follows:

Gly?Ser?Gln?Tyr?Ile?Lys?Ala?Asn?Ser?Lys?Phe?Ile?Gly?Ile?Thr?Glu

1 5 10 15

Ala?Ala?Ala?Glu?Phe?Asp?Phe?Gly?Leu?Asp?Cys?Asp?Glu?His?Ser?Thr

20 25 30

Glu?Ser?Arg?Cys?Cys?Arg?Tyr?Pro?Leu?Thr?Val?Asp?Phe?Glu?Ala?Phe

35 40 45

Gly?Trp?Asp?Trp?Ile?Ile?Ala?Pro?Lys?Arg?Tyr?Lys?Ala?Asn?Tyr?Cys

50 55 60

Ser?Gly?Glu?Cys?Glu?Phe?Val?Phe?Leu?Gln?Lys?Tyr?Pro?His?Thr?His

65 70 75 80

Leu?Val?His?Gln?Ala?Asn?Pro?Arg?Gly?Ser?Ala?Gly?Pro?Cys?Cys?Thr

85 90 95

Pro?Thr?Lys?Met?Ser?Pro?Ile?Asn?Met?Leu?Tyr?Phe?Asn?Gly?Lys?Glu

100 105 110

Gln?Ile?Ile?Tyr?Gly?Lys?Ile?Pro?Ala?Met?Val?Val?Asp?Arg?Cys?Gly?Cys

115 120 125

Ser?***?Val?Asp

130

Synthetic two couples of primer P1 of PCR and P2 and P3 and P4.Primer P1 and P2 sport BamH I and Sal I respectively with the restriction enzyme site of 5 ' end and 3 ' end, to make up the pQE-Ms recombiant plasmid; Primer P3 and P4 sport BamH I and EcoR I respectively with 5 ' end and the 3 ' restriction enzyme site of holding, to finish the reorganization with the pVAC1-cms plasmid.

Primer1：5’CG?GGATCC?GATTTTGGTCTTGACTGTG?3’

Primer2：5’GCGTCGACTCATGAGCACCCACAGCG?3’

Primer3：5’CG?GGATCC?CAGTATATAAAAGCAAATTCT?3’

Primer4：5’GCGAATTCTCATGAGCACCCACAGCG?3’

2 gene clones and vector construction

2.1 the structure of recombiant plasmid pQE-TT-Ms and pQE-Ms

With BamH I and Sal I double digestion pQE30 plasmid, the big fragment of plasmid is connected with synthetic TT-Ms gene order, makes up pQE-TT-Ms; With BamH I and SalI double digestion pQE30 plasmid and PCR product Ms, connect again.Connect product transformed competence colibacillus cell DH5 α, the picking positive colony, overnight incubation in the LB culture medium is extracted plasmid DNA, identifies and dna sequence analysis through enzyme action.Correct person's called after pQE-Ms and pQE-TT-Ms will check order.

2.2 the structure of recombiant plasmid pVAC-TT-Ms

The PCR product reclaims the purpose fragment after separating with 1.5% agarose gel electrophoresis.Genetic fragment with BamH I and EcoR I double digestion pVAC1-cms plasmid and recovery, the big fragment of plasmid that reclaims is connected with the TT-Ms fragment, connect product transformed competence colibacillus cell DH5 α, the picking positive colony, overnight incubation in the LB culture medium, extract plasmid DNA, identify and dna sequence analysis that through enzyme action correct person's called after pVAC-TT-Ms will check order.

The abduction delivering of 3 recombiant proteins, purification and evaluation

3.1 the abduction delivering of recombiant protein

Recombiant plasmid pQE-TT-Ms and pQE-Ms transformed competence colibacillus cell BL21 (DE3), picking monoclonal overnight incubation, m seq is inoculated in the LB culture medium in 1: 100 ratio, cultivates 2 hours to logarithmic growth mid-term, OD for 37 ℃ _600nmValue was at 0.4～0.6 o'clock, and adding final concentration is the IPTG of 0.1mM, continued to cultivate 4 hours, collected thalline and carried out SDS-PAGE.

3.2 the purification of destination protein and evaluation

SDS-PAGE

Get that 500 μ l induce or not inductive bacterium liquid centrifugal collecting precipitation, 2 * load sample buffer (5% beta-mercaptoethanol that adds 30 μ l water and 30 μ l, 4%SDS, 20% glycerol, 100mmol/L TrisHCl, pH6.8,0.2% bromophenol blue), behind the vibration mixing, boil 5min in the boiling water, the centrifugal 5min of 12000rpm gets 10 μ l supernatant application of samples and concentrates glue in 15% separation gel and 6%.Voltage rose to 120V electrophoresis 1h after constant voltage 90V electrophoresis behind the last sample, sample entered separation gel.

The separation of inclusion body and preliminary purification

STE buffer (the 100mM NaCl that adds 10ml by 1 gram thalline, 50mM TrisHCl (pH8.0)) ratio is resuspended with thalline, in ice bath, carry out the ultrasonic bacterium of splitting then, ultrasonic time 5s, blanking time 10s, power 200W, broken 15min, 4 ℃ of centrifugal 15min, 12000rpm, abandon supernatant, collecting precipitation.With cleaning mixture (2MUrea, 2%TritonX-100, STE) washing precipitation (adding the 20ml cleaning mixture) by 1 gram thalline, 4 ℃ are stirred 1h, 4 ℃ of centrifugal 15min of 12000rpm abandon supernatant, regather precipitation.Repeat to wash twice.

With degeneration A liquid (8M Urea, 10mM TrisHCl (PH 8.0), 100mM NaH ₂PO ₄) abundant balance Ni post, behind the last sample, with the A liquid eluting foreign protein that contains the 30mM imidazoles, reuse contains the A liquid eluting destination protein of 250mMl imidazoles, collects eluting peak, the dialysis renaturation.

Protein immunoblot (Western blot)

Albumen dialysis renaturation

Collect the eluent of Ni post, adopt urea concentration gradient dialysis process dialysis purifying protein to H ₂O solution.

The cultivation of 4 engineering bacterias

In the laboratory research stage, the applicant adopts triangle to shake bottle engineering bacteria is cultivated, and concrete steps are as follows: 1% activatory engineering bacteria is inoculated in the 500ml that contains 200ml LB culture medium and shakes in the bottle, and 37 ℃ of jolting 2.5h are to logarithmic growth mid-term, OD ₆₀₀About 0.4～0.6 o'clock, adding final concentration was the IPTG of 0.1mM, continued to cultivate 4h, the centrifugal 15min of 4500rpm, and the collection thalline splits bacterium immediately or-20 ℃ of preservations are standby.

The amplification of 5 recombiant plasmid and purification

5.1 the amplification of recombiant plasmid

Recombiant plasmid pVAC-TT-Ms, transformed competence colibacillus cell DH5 α, picking monoclonal overnight incubation, m seq is inoculated in 10ml in 1: 100 ratio and contains in the antibiotic LB culture medium of zeocin and cultivate 8h, is inoculated in 200ml in 1: 100 ratio again and contains the antibiotic LB culture medium of zeocin, shake bacterium 25h, 200rpm, receives bacterium by 37 ℃.

5.2 results of host bacterium and alkaline lysis

With suitable rotary head in 4 ℃ with 4000rpm centrifugal 20 minutes, abandon supernatant, bacterial precipitation is resuspended among the ice-cold STE of 100ml.

The bacterial precipitation thing of the 500ml culture that Xian is crossed is resuspended in 10ml (18ml) solution I (10mmol/LEDTA (pH8.0), autoclaving 15min is stored in 4 ℃ for 50mmol/L glucose, 25mmol/LTrisCl (pH8.0)).The lysozyme soln (10mg/ml is dissolved in 10mmol/LTrisCl (pH8.0)) that adds the new preparation of 2ml, add again the new preparation of 20ml (40ml) solution II (0.2mol/LNaOH, 1%SDS).Cover tight bottle cap, slowly put upside down centrifuge bottle for several times, fully the mixing content is placed 5～10min in room temperature.Add the ice-cold solution III of 15nl (20ml) (5mol/L potassium acetate 60ml, glacial acetic acid 11.5ml, water 28.5ml).Seal bottleneck, shake centrifuge bottle for several times with the mixing content, two clearly demarcated liquid phases should no longer appear in this moment.Put and put 10min on ice, should form a white flocculent deposit.Formed precipitation should comprise and dyes body DNA, high molecular RNA and potassium-SDS-protein-membrane complex after 0 ℃ of placement.

With suitable rotary head in 4 ℃ with the centrifugal 15min of 4000rpm, do not open brake and make the stall of rotary head nature.If bacterial debris is adherent not tight, can the centrifugal once again 20min of 5000rpm, carefully supernatant is all forwarded to then in another bottle, discard the viscous liquid that remains in the centrifuge tube.Supernatant is filtered in the 250ml centrifuge bottle, adds the isopropyl alcohol of 0.6 volume, and fully mixing is placed 10min in room temperature.In room temperature centrifugal 15 minutes, reclaim nucleic acid with suitable rotary head with 500rpm.As in 4 ℃ centrifugal, salt also can living precipitation.Carefully outwell supernatant, open wide bottleneck inversion centrifuge bottle remaining supernatant is flow to end, room temperature deposits tube wall with 70% washing with alcohol.Pour out ethanol, use the pasteur pipet sucking-off that links with vacuum equipment to invest all drops of bottle wall, the bottle inversion is placed on the napkin, the trace ethanol of last remnants is waved totally, with 3mlTE (pH8.0) dissolving nucleic acid precipitation in room temperature.

5.3 the purification of plasmid (polyethylene glycol precipitation)

Nucleic acid solution is changed in the 15ml Corex pipe, adds the ice-cold 5mol/L LiCl of 3ml solution again, abundant mixing, with suitable rotary head under 4 ℃ with the centrifugal 10min of 10000rpm.Supernatant is transferred in another 30ml Corex pipe, added the isopropyl alcohol of equivalent, abundant mixing, usefulness SorvallSS34 rotary head (or commentaries on classics point suitable with it) with the centrifugal 10min of 10000rpm, is reclaimed sedimentary nucleic acid in room temperature.Carefully remove supernatant, open wide the mouth of pipe, pipe is inverted so that the drop of final residual flows to end.Precipitate and tube wall with 70% washing with alcohol in room temperature, flow to end ethanol, use the pasteur pipet that links to each other with vacuum equipment to inhale all drops that remove to invest tube wall, open wide the mouth of pipe and will manage inversion, on napkin, place a few minutes, so that last remaining trace ethanol evaporation totally.

Contain TE (pH8.0) dissolution precipitation of the pancreas RNase (20 μ g/ml) of no DNase with 500 μ l, solution is forwarded in the microcentrifugal tube, place 3min in room temperature.Add the 1.6mol/LNaCl that 500 μ l contain 13% (w/v) Polyethylene Glycol (PEG 8000), fully mix, with microcentrifuge in 4 ℃ with the centrifugal 5min of 12000g, to reclaim plasmid DNA.The sucking-off supernatant is with 400 μ l TE (pH8.0) dissolving plasmid DNA precipitation.With phenol, phenol: chloroform, chloroform are respectively taken out 1 time.Water is forwarded in another microcentrifugal tube, add 100 μ l 10mol/L ethanol ammoniums, fully mixing adds 2 times of volumes (about 1ml) ethanol, in room temperature placement 10min, in 4 ℃ with the centrifugal 5min of 12000g, to reclaim sedimentary plasmid DNA.Supernatant is removed in suction, adds 200 μ l and is in 4 ℃ with the centrifugal 2min of 12000g.Supernatant is removed in suction, opens wide the mouth of pipe, makes the trace ethanol evaporation totally.Measure OD with 500 μ l TE (pH8.0) dissolution precipitations dilution in 1: 100 (with TE (pH8.0)) back ₂₆₀/ OD ₂₈₀, the concentration (1OD of calculating plasmid DNA ₂₆₀=50 μ g plasmid DNA/ml), then DNA is stored in-20 ℃.

The eukaryotic expression of 6 recombiant proteins

6.1 eukaryotic cell transfection and proteic expression

Chinese hamster ovary celI is cultivated based on 37 ℃ of 50ml/L CO with the low sugar DMEM that contains the 100ml/L hyclone ₂Cultivating under the condition.Be inoculated in respectively in 6 orifice plates that contain coverslip with certain density, continue to cultivate 24～48h, make the cell attachment more than 80%.The sucking-off culture fluid, the DMEM that uses the serum-free antibiotic-free is with twice of cell flushing.Get 2 μ g DNA and be dissolved in the 100 μ l serum-free antibiotic-free DMEM culture fluid, be called A liquid.With 10 μ l LipofectAMINE ^TM2000 are dissolved in the DMEM culture fluid of 90 μ l serum-free antibiotic-frees, place 10min, are called B liquid.A, B two liquid are mixed, and incubated at room 30min makes it form the DNA-liposome complex.Add the DMEM culture fluid of 800 μ l serum-free antibiotic-frees in complex, mixing slowly drops in the cell of washing gently, in 37 ℃, 50ml/LCO ₂Cultivate 7h under the condition.Transfection liquid is abandoned in suction, adds the DMEM culture fluid that 1ml contains the antibiotic-free of 200ml/L calf serum, in 37 ℃, 50ml/L CO ₂After continuing under the condition to cultivate 36h, carry out the detection of destination protein transient expression.

7 make up the evaluation of vaccine

Identify the structure of protein vaccine with Western Blot.

The proteic detection of 8 eukaryotic expressions

8.1 cellular immunization groupization

8.2RT-PCR

The extraction of cell total rna: get the Chinese hamster ovary celI after the transfection, abandon the Trizol (4 ℃ of pre-coolings) that adds 1ml behind the culture fluid,, make the thorough cracking of cell with 5min at the bottom of the continuous purge culture bottle of rifle.With the cell pyrolysis liquid sucking-off little centrifuge tube of packing into, 4 ℃ of centrifugal 10min of 12000rpm get supernatant and place 5min in room temperature; Concuss behind the adding 0.2ml chloroform fully mixes it, and room temperature is placed 5min; 4 ℃ of centrifugal 15min of 12000rpm make it to be divided into water and organic facies is two-layer, carefully take out the water (the superiors) at RNA place, add the 0.5ml isopropyl alcohol, mixing gently, and room temperature is placed 10min; 4 ℃ of centrifugal 10min of 12000rpm abandon supernatant; Add 75% ethanol with the water preparation that does not contain the RNA enzyme, washing precipitation once; 4 ℃ of centrifugal 5min of 7500rpm abandon supernatant; Drying at room temperature RNA 10min; Getting water that 10 μ l do not contain the RNA enzyme adds in the centrifuge tube and dissolves RNA; The nucleic acid quantification analyser detects OD ₂₆₀/ OD ₂₈₀And rna content.

The experiment of 9 immune animals

Myostatin gene vaccine and protein vaccine can induce in the mice body at this proteic antiserum, and the weight of animals of candidate gene vaccine and protein vaccine immunity increases, and the myocyte has loose phenomenon, and muscle quality and forelimb grip obviously increase.

9.1 laboratory animal

Laboratory animal is male BALB/c mouse, body weight 12～14g, and available from The Fourth Military Medical University's Experimental Animal Center, adaptability carries out immunity after feeding for 1 week.

9.2 mouse immune method

50 mices are divided into 5 groups, 10 every group, are respectively normal control group, pVAC group, pVAC-TT-Ms group, His-Ms group, His-TT-Ms group.

9.3ELISA mensuration serum antibody titer

9.3.1ELISA measure dna gene vaccine mice serum antibody titer

The preparation of required solution:

Bag is cushioned liquid: Na ₂CO ₃(0.32g final concentration 0.015mol/L), NaHCO ₃0.59g (final concentration 0.035mol/L), pure water are settled to 200ml (pH 9.6).

Cleaning mixture: the PBS (pH 7.4) that contains 0.05% Tween-20.

Confining liquid: the cleaning mixture that contains 1% BSA.

Diluent: the cleaning mixture that contains 0.5% BSA.

Substrate buffer solution: Na ₂HPO ₄12H ₂O 1.84g, citric acid 0.51g, pure water are settled to 100ml (pH5.0).

Substrate colour developing liquid: OPD 8mg, 30%H ₂O ₂30 μ l, substrate buffer solution 10ml.

Stop buffer: 1mol/L H ₂SO ₄

Operational approach:

Get 96 hole elisa plates, the supernatant soluble protein His-Ms that purification is dialysed to distilled water is cushioned liquid dilution (2～5 μ g/ml) with bag, adds in the plate hole (100 μ l/ hole), and 4 ℃ of bags are spent the night.Outwell coating buffer, add confining liquid, 37 ℃ of sealing 2h.Discard confining liquid, wash 6 times, each 3min with cleaning mixture.Add the antiserum (from 200 times) of 20 times of doubling dilutions, 1h is hatched for 37 ℃ in 100 μ l/ holes.Discard antiserum, wash 6 times, each 3min with cleaning mixture.Two of the goat-anti rabbit of adding HRP labelling resists, and 1h is hatched for 37 ℃ in 100 μ l/ holes.Discard two and resist, wash 6 times, each 3min with cleaning mixture.Add substrate colour developing liquid, 100 μ l/ holes, 37 ℃, colour developing 10～20min.Add stop buffer, 100 μ l/ holes, cessation reaction.The microplate reader reading is measured the light absorption value of every hole at 450nm.

9.3.2 cell ELISA is measured protein vaccine immune serum antibody titer

Chinese hamster ovary celI with 0.25% trypsinization after, adjusting cell concentration is 1.0 * 10 ⁶/ ml adds 96 porocyte culture plates, 37 ℃, 5% CO with 200 μ l holes ₂Cultivate 24h in the incubator, plasmid pVAC-TT-Ms and pVAC transfectional cell after the abundant adherent growth of 80% cell, method is the same.Behind the transfection 36h, inhale and to remove culture fluid, (PBS prepares, pH7.4) the fixing 20min of room temperature, PBS hole flushing 3 times with 0.025% glutaraldehyde for 37 ℃ of dry backs.Every hole adds 200 μ l and contains 3% H ₂O ₂PBS, room temperature reaction 20min, PBS hole flushing 3 times.Add different dilution test serums in the cell envelope hole respectively, every hole 200 μ l establish multiple hole, negative control, and 37 ℃ of incubator reaction 1h wash 3 times with washing liquid.Add 1: 10000 biotinylated goat anti-mouse igg antibody, every hole 200 μ l, 37 ℃ of reaction 1h, hole flushing 3 times dries.Add 1: 200 Avidin horseradish peroxidase, every hole 200 μ l, 37 ℃ of reaction 30min, hole flushing 3 times.Add OPD-H ₂O ₂Substrate 200 μ l, 37 ℃ of lucifuge reactions add 2M H ₂SO ₄Cessation reaction.Microplate reader is surveyed OD ₄₉₀The nm value.

9.4 serum conventional index assay method

Automatic clinical chemistry analyzer detects the serum index: total protein (TP), albumin (ALB), globulin (GLB), blood urea nitrogen (BUN), blood glucose (GLU), cholesterol (CHO), triglyceride (TG), creatine kinase (CK).Detection kit is all purchased and is built up bio-engineering research institute in Nanjing.

9.5 skeletal muscle morphological analysis method

9.5.1 skeletal muscle groupization

3.5.2 muscle fiber cross-sectional area statistics

Utilize Scion Image 4.02 softwares (http://www.scioncorp.com), press Lee etc. ^[18]Report has carried out statistical analysis to the area of muscle fiber cell.

9.6 grip strength testing method

With reference to Peled-Kamar etc. ^[116]Reported method is tightly tied up the rope of a diameter 2mm in liftoff 80cm eminence, allows the mice forelimb hold rope, picks up counting, touch rope to hind leg till, surpass 10s if forelimb and hind leg are held the rope time simultaneously, be once successful grip strength testing.1d and preceding 4d have carried out twice test to its forelimb grip before mice is put to death, and 3 repetitions are arranged at every turn, and every mice recurrence interval time is consistent as far as possible.

9.7 data statistics is handled

Carry out statistical disposition with 2000 pairs of data of surveying of Excel, (x ± SD) expression, data are organized a t check to experimental result with mean ± standard deviation.

The constructed Myostatin vaccine of the present invention can induce in the mice body at this proteic antiserum, and immune mouse makes mice skeletal quality and strength obviously improve.

Synthetic TT-Ms gene order

Gly?Ser?Gln?Tyr?Ile?Lys?Ala?Asn?Ser?Lys?Phe?Ile?Gly?Ile?Thr?Glu

1 5 10 15

Ala?Ala?Ala?Glu?Phe?Asp?Phe?Gly?Leu?Asp?Cys?Asp?Glu?His?Ser?Thr

20 25 30

Glu?Ser?Arg?Cys?Cys?Arg?Tyr?Pro?Leu?Thr?Val?Asp?Phe?Glu?Ala?Phe

35 40 45

Gly?Trp?Asp?Trp?Ile?Ile?Ala?Pro?Lys?Arg?Tyr?Lys?Ala?Asn?Tyr?Cys

50 55 60

Ser?Gly?Glu?Cys?Glu?Phe?Val?Phe?Leu?Gln?Lys?Tyr?Pro?His?Thr?His

65 70 75 80

Leu?Val?His?Gln?Ala?Asn?Pro?Arg?Gly?Ser?Ala?Gly?Pro?Cys?Cys?Thr

85 90 95

Pro?Thr?Lys?Met?Ser?Pro?Ile?Asn?Met?Leu?Tyr?Phe?Asn?Gly?Lys?Glu

100 105 110

Gln?Ile?Ile?Tyr?Gly?Lys?Ile?Pro?Ala?Met?Val?Val?Asp?Arg?Cys?Gly?Cys

115 120 125

Ser?***?Val?Asp

130