SOX5 postmitotically regulates migration, postmigratory differentiation, and projections of subplate and deep-layer neocortical neurons

Keywords: neocortex development, postmitotic mechanisms, pyramidal neurons, Sox genes, transcriptional enhancer

SOX5 Expression in SP and L6 Projection Neurons Coincides with Fezf2 Downregulation.

From a previous microarray screen (12), we selected Sox5 for further studies based on its distinct early-postnatal expression pattern in the deep neocortical layers: high in SP and L6, and lower in L5. This pattern was opposite to Fezf2 expression, which was highest in L5 and weaker in L6 and SP (12). To examine the expression of SOX5 in relation to Fezf2 during cortical development, we used the Fezf2-Gfp BAC transgenic mouse (Fezf2-Gfp) (17), in which GFP is expressed in a Fezf2 pattern (Fig. 1). At embryonic day 12.5 (E12.5), SOX5 was present in PP neurons but was absent from VZ progenitors and migratory CP neurons, both of which highly expressed Fezf2-Gfp. Although at E14.5 SOX5 was expressed only weakly in newly postmigratory L6 and SP neurons, SOX5 was upregulated markedly in these neurons starting at E16.5. Coincidently, Fezf2, which was highly expressed by SP, L6, and L5 neurons at E14.5, was greatly downregulated in SP and L6 neurons by E16.5, thereby creating the L5-enriched expression pattern observed at postnatal day 0 (P0). These concurrent reciprocal changes in SOX5 and Fezf2 expression in SP and L6 neurons suggest that these genes are functionally related. This suggestion is also supported by the evolutionary conservation of these complementary patterns in the mid-fetal human neocortex [supporting information (SI) Fig. S1]. Retrograde axonal tracing further revealed that at P7, SOX5 was expressed by a great majority of corticothalamic and corticospinal neurons and by a small proportion of callosal projection neurons in the deep layers (Fig. S2). Together, these results show that SOX5 is expressed in different subclasses of projection neurons, and its expression in SP and L6 neurons is associated with the postmigratory downregulation of Fezf2.

Neocortical Fezf2 Expression Is Altered in Sox5 KO Mice.

The complementary spatiotemporal expression patterns of SOX5 and Fezf2 suggest that SOX5 might regulate Fezf2 expression. Therefore, we analyzed Fezf2 expression in Sox5-null mice (KO; −/−), which exhibit a cleft palate and die hours after birth (13). Strikingly, in P0 KO neocortex, the pattern of Fezf2 mRNA and Fezf2-Gfp expression was shifted compared with heterozygotes (Het; +/−), with the highest levels in the deepest part of the KO neocortex (Fig. 2A). More importantly, Fezf2 mRNA expression, analyzed by quantitative RT-PCR, was significantly increased about twofold in the KO neocortex (Fig. 2B). These data indicate that Fezf2 expression is upregulated in the absence of Sox5, and its normal L5-enriched pattern is shifted toward deeper parts of the neocortex, consistent with a role of SOX5 in repressing Fezf2 in SP and L6 neurons.

SOX5 Binds and Represses an Evolutionarily Conserved Enhancer Near the Fezf2 Gene.

To explore a mechanism by which SOX5 represses Fezf2 expression, we examined putative regulatory sequences near the Fezf2 genomic locus. An evolutionarily conserved region (434 enhancer) downstream of the human FEZF2 transcription start site exhibits enhancer activity resembling the pattern of Fezf2 in E11.5 transgenic mice (VISTA Enhancer Browser) (Fig. S3A–C) (18). Furthermore, the orthologous mouse sequence exhibited activity in deep-layer neurons similar to endogenous Fezf2 expression (Fig. S3D). These results, although not definitive, suggest that this enhancer regulates Fezf2 transcription. Analysis using MatInspector revealed that this putative Fezf2 regulatory element contains two pairs of highly conserved consensus binding sites for SOX5 (Fig. 2C). To determine SOX5 binding of these sites, we performed chromatin immunoprecipitation (ChIP) with cortices dissected from P0 mice, using KO mice to control for possible nonspecific antibody binding (n = 2 per genotype). Both of the anti-SOX5 antibodies used specifically precipitated this DNA in Het but not KO mice, confirming in vivo binding of SOX5 (Fig. 2D). To test whether SOX5 binding has functional consequences, we cloned the 82-bp sequence containing both pairs of SOX5 binding sites, as well as mutated versions thereof, downstream of the luciferase reporter gene for luciferase assays in N2a cells (Fig. 2 E and F). SOX5 significantly repressed the activity of the wild-type enhancer by 51.5% ± 1.7%. Mutating the binding sites rescued the repression to varying degrees, whereas mutations in all four sites rescued the repression almost completely. Collectively, these results indicate that SOX5 binds to and represses the activity of a conserved enhancer element proximal to the Fezf2 locus.

Alterations in Expression Pattern of Subplate and Deep-Layer Markers in Sox5 KO Neocortex.

Next, we analyzed the cytoarchitecture and marker expression of the P0 KO brain. Nissl staining revealed no gross structural abnormalities (Fig. S4). However, a well-delineated SP was absent in the KO neocortex. The expression of RELN, a marker of layer 1 (19), was not affected (Fig. S5A). Expression of Ctgf, a marker of SP (20), was reduced dramatically in the KO neocortex. Tle4, a marker of L6 and SP (21), was unperturbed in deep CP but was largely lost below, where the SP normally is situated (Fig. S5B). ZFPM2 (FOG2) (12) and TBR1 (22), both normally expressed in L6 and SP neurons, exhibited slightly reduced expression in the KO neocortex. A number of ZFPM2- and TBR1-expressing neurons were positioned ectopically in the upper layers (Fig. S5B). Analysis of L5 markers BCL11B (10) and ETV1 (ER81) (23) showed striking shifts toward deeper positions in the KO neocortex, similar to Fezf2 (Fig. S5C). However, in lateral KO neocortex, BCL11B was dramatically downregulated, and the ETV1 shift was less prominent (data not shown), indicating possible alterations in areal patterning. Rorb, a marker of L4 (24), and CUTL1 (CUX1) (25), a marker of the upper layers, were largely unaffected (Fig. S5D). These data show that loss of SOX5 specifically affects deep-layer gene expression, decreasing the expression of SP and L6 markers and shifting the expression of BCL11B, ETV1, and Fezf2 from L5 to deeper positions in the neocortex.

Deep-Layer Neurons Exhibit Mixed Molecular Properties in Sox5 KO Neocortex.

To examine the molecular properties of the KO neocortex further, we analyzed whether markers typically selective for L5 or L6 became abnormally coexpressed. At P0, BCL11B and ZFPM2 normally are highly expressed in L5 and L6, respectively, with little overlap. To quantify their co-expression, the distribution of cells singly expressing BCL11B or ZFPM2 or co-expressing both was analyzed (Fig. 3A). In the KO neocortex, the number of cells co-expressing BCL11B and ZFPM2 increased significantly compared with the Het neocortex. Because Het and KO mice express lacZ from the Sox5 locus in a Sox5 pattern, lacZ staining was used to mark neurons that normally would express Sox5. In the Het neocortex, Fezf-Gfp was expressed only occasionally in lacZ-expressing neurons. In the KO neocortex, lacZ-expressing neurons co-expressed Fezf2-Gfp extensively (Fig. 3B), indicating an upregulation of Fezf2 in these cells in the absence of Sox5. In a very small number of KO mice that survived past birth (4 of > 200 KO mice), possibly because of variability in cleft palate severity, BCL11B, ZFPM2, and Fezf2-Gfp co-expression persisted at P7 (Fig. S6A). Collectively, these data indicate that some neurons in the KO neocortex exhibit abnormal mixed molecular properties of both L5 and L6. However, numerous neurons maintained normal single expression of BCL11B or ZFPM2, indicating that not all deep-layer neurons became molecularly mixed in the KO neocortex.

SP and L6 Neurons Fail to Down-Regulate Fezf2 and BCL11B in Sox5 KO Neocortex During Late Embryonic Development.

The mixed molecular identities of neurons in the postnatal KO neocortex could be caused by abnormal induction of BCL11B and Fezf2 or by their failed downregulation after transient expression. The latter possibility is supported by the downregulation of initially high Fezf2 expression in normal SP and L6 neurons between E14.5 and E16.5 (Fig. 1). Therefore, we examined the co-expression of Fezf2-Gfp, BCL11B, and ZFPM2 during embryonic development. Remarkably, in the E12.5 and E14.5 Het neocortex, before the onset of high SOX5 expression, the majority of ZFPM2-expressing PP, SP, and L6 neurons co-expressed high levels of Fezf2-Gfp and BCL11B (Fig. 3C). Coinciding with increased SOX5 expression in SP and L6 at E16.5, BCL11B and Fezf2-Gfp expression showed reduced overlap with ZFPM2, indicating that the postnatal expression patterns of these markers were acquired progressively through the downregulation of Fezf-Gfp and BCL11B by ZFPM2-expressing SP and L6 neurons. We further confirmed that this downregulation occurred intrinsically by birth-dating SP and L6 neurons born at E11.5 with 5-iodo-2-deoxyuridine (IdU). In Het neocortex, a large proportion of neurons born at E11.5 expressed high levels of Fezf2-Gfp or BCL11B at E14.5 (59.9% ± 6.5% and 73.9% ± 5.3%, respectively) (Fig. 3 D and E), whereas a smaller proportion did so at E16.5 (26.0% ± 3.3% and 32.2% ± 3.4%). By P0, only a small proportion of these neurons expressed either gene at detectable levels (11.6% ± 2.7% and 12.2% ± 2.1%).

In the E12.5 and E14.5 KO neocortex, Fezf2-Gfp, BCL11B and ZFPM2 were co-expressed in CP neurons, as found in Het neocortex (Fig. 3C). However, this co-expression was aberrantly maintained at high levels in the E16.5 and P0 KO neocortex (Fig. 3C and data not shown). Similarly, the proportion of E11.5 IdU-labeled neurons highly expressing Fezf2-Gfp or BCL11B in the E14.5 KO neocortex (52.9 ± 4.2% and 67.4 ± 4.4%, respectively) (Fig. 3 D and E) was comparable to that in the Het neocortex. However, a high proportion of these neurons maintained strong expression of Fezf2-Gfp or BCL11B at E16.5 (46.6% ± 7.4% and 70.7% ± 2.2%, respectively) and P0 (48.4% ± 3.1% and 71.0% ± 2.6%, respectively), indicating that these genes were not downregulated appropriately.

Collectively, these data indicate that newly postmigratory SP and L6 neurons transiently expressed and, during differentiation, progressively downregulated molecular markers postnatally enriched in L5 neurons. The timing of this postmitotic refinement coincides with the upregulation of SOX5 expression in these neurons, and in the KO neocortex postnatal Fezf2-Gfp and BCL11B expression is maintained abnormally in SP and L6 neurons because of the failure of this downregulation.

Laminar Positioning Defects of Subplate and Deep-Layer Neurons in Sox5 KO Neocortex.

The ectopic ZFPM2- and TBR1-expressing neurons in the upper layers of the KO neocortex suggest alterations in neuronal migration. Therefore, we used 5-chloro-2-deoxyuridine (CldU) and IdU to birth-date SP and deep-layer neurons at E11.5, E12.5, and E13.5 (n = 3 per genotype) and upper-layer neurons at E15.5 and E16.5 (n = 2) and then analyzed their radial distribution at P0 (Fig. S7). In the KO neocortex, neurons labeled at E11.5 and E12.5 shifted dramatically away from the SP toward more superficial layers. Many E11.5-labeled neurons were positioned immediately below layer 1, suggesting that some SP neurons were not separated from the MZ during PP splitting, as shown by Lai et al. (14). The distribution of upper-layer neurons labeled at E15.5 and E16.5 were normal in the KO cortex, indicating that the migration defects in the KO cortex specifically affected early-born SP and deep-layer neurons.

Aberrant Preplate Splitting Caused by Premature Migration Arrest in Sox5 KO Neocortex.

To analyze further the partitioning of the PP, we examined expression of PP, SP, and L6 markers at E14.5 (Fig. 4A). In the Het neocortex, MAP2 expression formed distinct bands in the MZ and SP. In the KO neocortex, SP expression of MAP2 is lost, and the domain of MAP2 expression in the MZ is expanded. The expression of ZFPM2, TBR1, and lacZ shifted to the upper edge of the CP, immediately below the MZ. To investigate further the relative positions of early-born SP and L6 neurons, we injected IdU at E11.5 and CldU at E12.5 and examined labeled cells at E14.5 (Fig. 4 B and C). In the Het neocortex, cells labeled at E11.5 occupied the SP, with those labeled at E12.5 immediately above in the SP and deep CP. In the KO neocortex, cells labeled at E11.5 occupied the upper edge of the CP (Fig. 4B), immediately below the MZ, whereas those labeled at E12.5 were positioned just below. Therefore, in the KO neocortex, neurons born at E12.5 failed to migrate past those born 1 day earlier, prematurely arresting immediately below and resulting in failed PP splitting and an inversion of the early-born neurons.

Loss of Subcerebral and Misrouting of Corticothalamic Projections in Sox5 KO Mice.

The KO defects in SP, which is critical for proper targeting of subcortical axons (26, 27), prompted us to investigate whether projections were altered. To analyze layer-specific projections, we anterogradely traced subcortical axons using GFP expressed from two layer-specific transgenes; Fezf2-Gfp, highly expressed in L5 neurons, and Golli-Gfp, exclusively expressed in SP and L6 neurons (28). In the P0 Het brain, both Fezf2-Gfp- and Golli-Gfp-positive corticothalamic axons were abundantly present and invaded the dorsal thalamus via separate paths (Fig. 5 A and C). In the KO brain, Fezf-Gfp-positive axons reaching the dorsal thalamus were greatly reduced, and their paths in the internal capsule lacked stereotypical organization (Fig. 5A). Strikingly, Golli-Gfp-positive axons failed to enter the internal capsule, and none reached the dorsal thalamus (Fig. 5C). Sections through the pons revealed tightly bundled Fezf-Gfp-positive subcerebral axons in the Het mice (Fig. 5A). In the KO mice, only a few small bundles of Fezf-Gfp-positive subcerebral axons reached the pons. Although numerous Golli-Gfp-positive axons innervated the pons in the Het mice, none reached any subcerebral levels in the KO mice (Fig. 5C).

Analysis of KO brain also revealed numerous misrouted Fezf-Gfp- and Golli-Gfp-positive axons, most prominently an aberrant tract misdirected into the hypothalamus (Fig. 5 A and C), indicating defects in axonal pathfinding. At caudal levels of the Het cerebrum, Fezf-Gfp- and Golli-Gfp-positive axons were present in the cerebral peduncles but not in the lateral hypothalamic area (LHA) marked by immunostaining for melanin-concentrating hormone (Fig. 5 B and D) (29). In the KO caudal cerebrum, however, Fezf-Gfp- and Golli-Gfp-positive axons were significantly reduced in the cerebral peduncles and aberrantly invaded the LHA. Serial sections through the rostral midbrain revealed that these aberrant axons were not present at any subcerebral levels (data not shown), indicating that they terminated within the hypothalamus. These axon defects, which persisted in P7 KO mice (Fig. S6B), were confirmed pan-cortically using the Emx1-Cre;CAG-Cat-Gfp transgenic mice (30) that expressed GFP in axons arising from all cortical projection neurons (Fig. S8A–C) and by immunostaining for L1-CAM (Fig. S6B). Furthermore, diotadecyl-tetramethylindocarbocyanine (DiI) retrograde tracing from the dorsal thalamus confirmed a significant decrease in corticothalamic axons and revealed a shift in their laminar origin in the KO mice (Fig. S8D–F), consistent with migration defects. Taken together, these data indicate that multiple subcortical projections were reduced dramatically and were misrouted to the hypothalamus in the KO mice. This disruption was layer specific, affecting axons arising from SP and L6 neurons more severely than those from L5. Importantly, despite aberrant maintenance of Fezf2 and BCL11B expression, L6 and SP neurons did not acquire the subcerebral connectivity of L5 neurons in the KO mice.

Sox5 Is Insufficient to Induce Ectopic Subcortical Axonal Projections or Respecify Normal Callosal Projections.

To determine whether SOX5 is intrinsically sufficient to induce subcortical axonal projections, we carried out in utero electroporation (31) at E15.5 to overexpress SOX5 specifically in upper-layer neurons (Fig. 6). To control for timing of injection, a Sox5 overexpression construct with the GFP reporter was injected into one cortical hemisphere, and a control RFP construct was injected into the contralateral hemisphere (n = 4). At P7, SOX5 overexpression was confirmed in electroporated GFP-expressing neurons by immunofluorescent staining (Fig. 6D). Some surrounding neurons endogenously expressed low levels of SOX5, confirming that SOX5 is weakly expressed by normal upper-layer neurons at this age (Fig. 1). Both control RFP-positive and SOX5-overexpressing GFP-positive neurons exhibited typical pyramidal morphology and normal radial distribution (Fig. 6A). Analysis of projections revealed that SOX5-expressing GFP-positive axons were indistinguishable from RFP control, abundantly entering the corpus callosum and extending short branches to the upper striatum (Fig. 6 A and B), consistent with previous data that some upper-layer neurons normally extend short axon branches to the dorsal striatum (12, 32). Neither RFP- nor GFP-expressing axons reached the internal capsule or thalamus or any subcerebral levels (Fig. 6C). Consistently, overexpression of SOX5 by electroporation at E12.5 and E14.5 (data not shown) also failed to suppress callosal axons or induce additional subcortical projections. Together, these results show that SOX5 overexpression is not sufficient to respecify callosal projections or to induce ectopic subcortical axonal projections.

Animals.

All experiments were carried out in accordance with a protocol approved by the Yale Committee on Animal Research.

Luciferase Assays.

N2a cells were transfected with pCAG-Sox5 or empty pCAGEN, firefly luciferase (pGL3) containing wild-type or mutated SOX5 binding sites and Renilla luciferase (pRL-SV40) and were assayed 48 h later.

Chromatin Immunoprecipitation.

P0 cortices of KO and Het mice were minced, cross-linked with 1 mM disuccinimidyl glutarate and 1% formaldehyde, and processed using EZ-ChIP (Millipore). Capture of the enhancer region was tested by PCR using primers ChIP-F, TGGACTTTTCTTTTCTGCCTCT and ChIP-R, CATGCACATGCAAAACACAG.

In Utero Electroporation.

Approximately 2 μl of DNA (4 μg/μL) were injected into the lateral ventricles and transferred into VZ cells by electroporation (five 50-ms pulses of 40 V at 950-ms intervals).

Further experimental details can be found in SI Materials and Methods.

Supporting Information

• 1.O'Leary D, Koester S. Development of projection neuron types, axon pathways, and patterned connections of the mammalian cortex. Neuron. 1993;10:991–1006. doi: 10.1016/0896-6273(93)90049-w. [DOI] [PubMed] [Google Scholar]
• 2.McConnell S. Constructing the cerebral cortex: Neurogenesis and fate determination. Neuron. 1995;15:761–768. doi: 10.1016/0896-6273(95)90168-x. [DOI] [PubMed] [Google Scholar]
• 3.Molyneaux B, Arlotta P, Menezes J, Macklis J. Neuronal subtype specification in the cerebral cortex. Nat Rev Neurosci. 2007;8:427–437. doi: 10.1038/nrn2151. [DOI] [PubMed] [Google Scholar]
• 4.Angevine JJ, Sidman R. Autoradiographic study of cell migration during histogenesis of cerebral cortex in the mouse. Nature. 1961;192:766–768. doi: 10.1038/192766b0. [DOI] [PubMed] [Google Scholar]
• 5.Rakic P. Neurons in rhesus monkey visual cortex: Systematic relation between time of origin and eventual disposition. Science. 1974;183:425–427. doi: 10.1126/science.183.4123.425. [DOI] [PubMed] [Google Scholar]
• 6.Marin-Padilla M. Dual origin of the mammalian neocortex and evolution of the cortical plate. Anat Embryol (Berlin) 1978;152:109–126. doi: 10.1007/BF00315920. [DOI] [PubMed] [Google Scholar]
• 7.Rash B, Grove E. Area and layer patterning in the developing cerebral cortex. Curr Opin Neurobiol. 2006;16:25–34. doi: 10.1016/j.conb.2006.01.004. [DOI] [PubMed] [Google Scholar]
• 8.Caviness VJ. Neocortical histogenesis in normal and reeler mice: A developmental study based upon [3H]thymidine autoradiography. Brain Res. 1982;256:293–302. doi: 10.1016/0165-3806(82)90141-9. [DOI] [PubMed] [Google Scholar]
• 9.Molyneaux B, Arlotta P, Hirata T, Hibi M, Macklis J. Fezl is required for the birth and specification of corticospinal motor neurons. Neuron. 2005;47:817–831. doi: 10.1016/j.neuron.2005.08.030. [DOI] [PubMed] [Google Scholar]
• 10.Arlotta P, et al. Neuronal subtype-specific genes that control corticospinal motor neuron development in vivo. Neuron. 2005;45:207–221. doi: 10.1016/j.neuron.2004.12.036. [DOI] [PubMed] [Google Scholar]
• 11.Chen B, Schaevitz L, McConnell S. Fezl regulates the differentiation and axon targeting of layer 5 subcortical projection neurons in cerebral cortex. Proc Natl Acad Sci U S A. 2005;102:17184–17189. doi: 10.1073/pnas.0508732102. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 12.Chen J, Rasin M, Kwan K, Sestan N. Zfp312 is required for subcortical axonal projections and dendritic morphology of deep-layer pyramidal neurons of the cerebral cortex. Proc Natl Acad Sci USA. 2005;102:17792–17797. doi: 10.1073/pnas.0509032102. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 13.Smits P, et al. The transcription factors L-Sox5 and Sox6 are essential for cartilage formation. Dev Cell. 2001;1:277–290. doi: 10.1016/s1534-5807(01)00003-x. [DOI] [PubMed] [Google Scholar]
• 14.Lai T, et al. SOX5 Controls the sequential generation of distinct corticofugal neuron subtypes. Neuron. 2008;57:232–247. doi: 10.1016/j.neuron.2007.12.023. [DOI] [PubMed] [Google Scholar]
• 15.Lefebvre V, Dumitriu B, Penzo-Méndez A, Han Y, Pallavi B. Control of cell fate and differentiation by Sry-related high-mobility-group box (Sox) transcription factors. Int J Biochem Cell Biol. 2007;39:2195–2214. doi: 10.1016/j.biocel.2007.05.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 16.Stolt C, et al. SoxD proteins influence multiple stages of oligodendrocyte development and modulate SoxE protein function. Dev Cell. 2006;11:697–709. doi: 10.1016/j.devcel.2006.08.011. [DOI] [PubMed] [Google Scholar]
• 17.Gong S, et al. A gene expression atlas of the central nervous system based on bacterial artificial chromosomes. Nature. 2003;425:917–925. doi: 10.1038/nature02033. [DOI] [PubMed] [Google Scholar]
• 18.Pennacchio L, et al. In vivo enhancer analysis of human conserved non-coding sequences. Nature. 2006;444:499–502. doi: 10.1038/nature05295. [DOI] [PubMed] [Google Scholar]
• 19.Rice D, Curran T. Role of the reelin signaling pathway in central nervous system development. Annu Rev Neurosci. 2001;24:1005–1039. doi: 10.1146/annurev.neuro.24.1.1005. [DOI] [PubMed] [Google Scholar]
• 20.Heuer H, et al. Connective tissue growth factor: A novel marker of layer VII neurons in the rat cerebral cortex. Neuroscience. 2003;119:43–52. doi: 10.1016/s0306-4522(03)00100-3. [DOI] [PubMed] [Google Scholar]
• 21.McEvilly R, de Diaz M, Schonemann M, Hooshmand F, Rosenfeld M. Transcriptional regulation of cortical neuron migration by POU domain factors. Science. 2002;295:1528–1532. doi: 10.1126/science.1067132. [DOI] [PubMed] [Google Scholar]
• 22.Hevner R, et al. Tbr1 regulates differentiation of the preplate and layer 6. Neuron. 2001;29:353–366. doi: 10.1016/s0896-6273(01)00211-2. [DOI] [PubMed] [Google Scholar]
• 23.Yoneshima H, et al. Er81 is expressed in a subpopulation of layer 5 neurons in rodent and primate neocortices. Neuroscience. 2006;137:401–412. doi: 10.1016/j.neuroscience.2005.08.075. [DOI] [PubMed] [Google Scholar]
• 24.Nakagawa Y, O'Leary DD. Dynamic patterned expression of orphan nuclear receptor genes RORalpha and RORbeta in developing mouse forebrain. Dev Neurosci. 2003;25:234–244. doi: 10.1159/000072271. [DOI] [PubMed] [Google Scholar]
• 25.Nieto M, et al. Expression of Cux-1 and Cux-2 in the subventricular zone and upper layers II-IV of the cerebral cortex. J Comp Neurol. 2004;479:168–180. doi: 10.1002/cne.20322. [DOI] [PubMed] [Google Scholar]
• 26.McConnell S, Ghosh A, Shatz C. Subplate neurons pioneer the first axon pathway from the cerebral cortex. Science. 1989;245:978–982. doi: 10.1126/science.2475909. [DOI] [PubMed] [Google Scholar]
• 27.Kostovic I, Rakic P. Developmental history of the transient subplate zone in the visual and somatosensory cortex of the macaque monkey and human brain. J Comp Neurol. 1990;297:441–470. doi: 10.1002/cne.902970309. [DOI] [PubMed] [Google Scholar]
• 28.Jacobs E, et al. Visualization of corticofugal projections during early cortical development in a tau-GFP-transgenic mouse. Eur J Neurosci. 2007;25:17–30. doi: 10.1111/j.1460-9568.2006.05258.x. [DOI] [PubMed] [Google Scholar]
• 29.Bittencourt J, et al. The melanin-concentrating hormone system of the rat brain: An immuno- and hybridization histochemical characterization. J Comp Neurol. 1992;319:218–245. doi: 10.1002/cne.903190204. [DOI] [PubMed] [Google Scholar]
• 30.Iwasato T, et al. Cortical adenylyl cyclase 1 is required for thalamocortical synapse maturation and aspects of layer IV barrel development. J Neurosci. 2008;28:5931–5943. doi: 10.1523/JNEUROSCI.0815-08.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 31.Rasin M, et al. Numb and Numbl are required for maintenance of cadherin-based adhesion and polarity of neural progenitors. Nat Neurosci. 2007;10:819–827. doi: 10.1038/nn1924. [DOI] [PubMed] [Google Scholar]
• 32.Gerfen C. The neostriatal mosaic: Striatal patch-matrix organization is related to cortical lamination. Science. 1989;246:385–388. doi: 10.1126/science.2799392. [DOI] [PubMed] [Google Scholar]
• 33.Alcamo E, et al. Satb2 regulates callosal projection neuron identity in the developing cerebral cortex. Neuron. 2008;57:364–377. doi: 10.1016/j.neuron.2007.12.012. [DOI] [PubMed] [Google Scholar]
• 34.Britanova O, et al. Satb2 is a postmitotic determinant for upper-layer neuron specification in the neocortex. Neuron. 2008;57:378–392. doi: 10.1016/j.neuron.2007.12.028. [DOI] [PubMed] [Google Scholar]
• 35.Jessell T. Neuronal specification in the spinal cord: Inductive signals and transcriptional codes. Nat Rev Genet. 2000;1:20–29. doi: 10.1038/35049541. [DOI] [PubMed] [Google Scholar]

Supplementary Materials