HIV–1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs

Multipotent HPCs are susceptible to HIV infection

To assess the developmental capacity of infected HPCs, we used a minimal HIV genome (HIV–7SF–GFP, Fig. 1d) pseudotyped with 89.6 Env, which “tagged” infected cells without causing cell death. Using this system, we found that a proportion of CD34⁺ cells were infected (GFP⁺) [1 to 6% in replicate experiments (e.g. Fig. 3a; initial sort purity shown in Supplementary Fig. 2a)] and a more primitive subset of these cells (CD34⁺CD38⁻CD133⁺) had a similar infection rate (Fig. 3b). Infection of CD133⁺ HPCs purified from BM yielded similar results (Supplementary Fig. 2f and g). These infection rates were comparable to the fraction of CD34⁺ cells expressing both HIV co–receptors (Supplementary Fig. 3a and b).

CD133⁺ HPCs from UCB infected with HIV–7SF–GFPenv^89.6 generated GFP⁺ colonies of erythroid (CFU–E), myeloid (CFU–M and CFU–GM) and multi–lineage (CFU–GEMM) origin, demonstrating that HIV can infect multipotent HPCs (Fig. 3c). Quantitation revealed similar numbers of total colonies from uninfected and infected cells (Fig. 3d). Similar results were obtained using a full–length HIV reporter (89.6–SIΔE–SF–GFP, Fig. 1e) that did not express HIV genes because of an LTR mutation (Fig. 3e,f).

Induction of latent HIV from infected HPCs

To assess latent infection, we asked whether induction of differentiation induced viral gene expression. Indeed, BM–derived HPCs (99.5% CD34⁺, Supplementary Fig. 2b) infected with replication defective [HIV HXB–ePLAPenv^VSV–G (Fig. 1f)] and treated with PMA expressed the reporter in 12-fold more cells (Fig. 4a) and produced more viral particles (Supplementary Fig. 4a) than the control. BM immunodepleted for CD34⁺ cells were not viable under these conditions (Supplementary Fig. 4b).

We found similar numbers of integrated genomes plus or minus PMA (Fig. 4b), indicating that PMA–induced gene expression was not due to effects on integration. Consistent with these results, the integrase inhibitor raltegravir blocked initial infection but not PMA–induced gene expression (Supplementary Fig. 5). Similar results were obtained using HXB–ePLAPenv^89.6, albeit with lower infection rates (Fig. 4c).

Using wild type HIV–89.6 (Fig. 1b), we infected purified BM–derived HPCs (98% CD34⁺, Supplementary Fig. 2d) and cultured them plus or minus GM–CSF and TNF–α to induce myeloid differentiation ¹⁰. GM–CSF–TNF–α–treatment of infected HPCs resulted in rapid release of HIV into the culture supernatant (Fig. 4d). In contrast, BMMCs immunodepleted for CD34⁺ cells did not release HIV (Fig 4d) and rapidly died (Supplementary Fig 4 b, c, d and f). Flow cytometric analysis of the cells confirmed that GM–CSF–TNF–α stimulated intracellular HIV Gag expression (Fig. 4e) and that cells cultured in GM–CSF–TNF–αacquired myeloid markers (CD83⁺) (Fig. 4f).

To assess the stability of latent HIV in HPCs, we infected CD34⁺ BM–derived HPCs (99% pure, Supplementary Fig. 2e) with wild type 89.6. After 7 d, when the culture was uniformly Gag–negative, GM–CSF–TNF–α was added to half the culture. GM-CSF-TNF-α resulted in a resurgence of HIV gene expression compared with the untreated culture (Fig 4g, h). 89.6 is a dual tropic HIV that can utilize both CCR5 and CXCR4 to enter cells. Similar results were obtained with a wild type virus that only uses CXCR4 although, as expected, there was less viral spread in the differentiated myeloid cells (Supplementary Fig. 6b). Spread of infection in the culture was inhibited by antiretrovirals and supernatant from infected cells could be used to infect T cell lines (Supplementary Fig. 6).

Direct detection of latency

To detect latent infection in situ without inducing changes in the infected cells, we developed a novel latency reporter virus [89.6–ΔE–SF–GFP (Fig. 1c)] that expresses GFP independently of the HIV LTR. Infection of T cells with 89.6–ΔE–SF–GFPenv^89.6 yields some cells expressing Gag and others expressing only GFP (Fig. 5a). To confirm that GFP⁺Gag⁻ cells were latently infected, we demonstrated that CD4 downmodulation, which occurs only when HIV Nef, Vpu or Env is expressed, ¹¹ occurred in Gag⁺ but not GFP⁺Gag⁻ cells (Fig. 5a). In contrast, when cells were infected with a virus that expressed GFP from the HIV LTR (89.6–ΔE–IRES–GFP, Fig. 1g), GFP–expressing cells downmodulated CD4 (Fig. 5a). Similar results were obtained using peripheral blood mononuclear cells (PBMCs) infected with 89.6ΔE–SF–GFPenv^89.6 (Fig. 5b). Moreover, PMA and ionomycin treatment of Jurkat cells infected with the reporter virus increased Gag⁺ cell frequency and reduced GFP⁺Gag⁻ cell frequency (Fig. 5c).

We observed separate populations of Gag⁺ and GFP⁺ cells in UCB–derived CD34⁺ HPCs infected with the latency reporter virus, indicating that active and latent infection occurred in this cell type (Fig. 5d). In culture, the Gag⁺ cells were rapidly lost whereas the GFP⁺Gag⁻cells persisted at least 20 d (Fig. 5e, Supplementary Fig 1d). Analysis of these cells revealed that many had a cell surface phenotype consistent with primitive HPCs (CD34⁺Lin⁻ or CD34⁺CD38⁻)(Fig. 5f).

Antibodies

CD4: OKT4 conjugated to FITC (Fluorotag, Sigma–Aldrich); CD34: FITC–conjugated (BD Biosciences) or APC–conjugated (Caltag); CD38: PE–Cy7–conjugated (eBioscience); CD133: PE–conjugated (Miltenyi); CCR5: PE–conjugated (eBioscience); CXCR4: PE–conjugated (eBioscience); Gag: clone KC57 conjugated to FITC or PE (Coulter); lineage markers: FITC-conjugated (BD Biosciences) or lineage cocktail (BD Biosciences) conjugated to biotin (EZ Link Sulfo–NHS–Biotin, Pierce Biotechnology) or PE–Cy5.5 (Lightning Link PE–Cy5.5, Innova Biosciences); PLAP (serotec); goat antibody to mouse immunoglobulin: PE–conjugated (Invitrogen).

Plasmid constructs

p89.6ΔE was generated by dropping out a BsaBI–StuI fragment from p89.6. The 89.6 env expression vector pCDNA–89env was created by cloning the HindIII and EcoRV fragment into pcDNA3.1(+).

To construct p89.6–ΔE–SF–GFP, a BamH–KpnI fragment containing the SFFV promoter from pHIV–7/SF–GFP was sub–cloned into pCDNA3.1(+), replacing the original CMV promoter. A BamHI–XbaI fragment from pEGFP–N2–LAMP1 was inserted downstream of the promoter. Next, a nef^89.6 PCR product was ligated into MfeI cut pSFDNA–EGFP, generating pNef–SFFV–EGFP. Then a PCR product generated using the primers: 5′–CACCATTATCGTTTCAGACCCT–3 ′ and 5 ′–TCTCGAGTTTAAACTTATAGCAAAGCCCTTTCCA–3′ with p89.6 as a template was ligated into p89.6 (p89.6ΔNE). Finally, a PmeI fragment from pNef–SFFV–EGFP was cloned into PmeI–cut p89.6ΔNE.

Standard PCR mutagenesis approaches were used to delete the 3′ U3 region of the viral LTR of p89.6–ΔE–GFP, analogous to those previously described ¹⁵. The resulting U3 deletion eliminates all consensus AP–1, NF–AT, NF–κB SP–1 and TATA motifs, but maintains the polyA site found in the R region.

Cell culture

Fresh whole bone marrow aspirates were obtained commercially (AllCells ltd.). Pre-existing umbilical cord blood lacking patient identifiers was obtained following scheduled cesarean section procedures. Bone marrow mononuclear cells (BMMCs) and cord blood mononuclear cells (UCB) were prepared by density separation using Ficoll–Paque (GE healthcare) according to the manufacturer’s instructions.

CD34⁺ cells were prepared from adherence depleted mononuclear cells using commercially available kits [EasySep CD34 positive selection kit, StemCell Technologies and CD34 MACS positive selection, Miltenyi, biotin selection kit with CD34–biotin antibody (Invitrogen)] according to the manufacturer’s instructions. CD133⁺ cells were isolated similarly, using CD133 positive selection MACS (Miltenyi).

Following isolation, CD34⁺ cells were maintained in StemSpan (StemCell Technologies) or Stemline (Sigma–Aldrich) medium supplemented with CC110 (StemCell Technologies) cytokine cocktail (100 ng ml⁻¹ SCF, 100 ng ml⁻¹ Flt3–L and 100 ng ml⁻¹ TPO). To expand immature progenitor cells for colony formation assays, media was supplemented with STIF cytokine cocktail (CC110 plus 100 ng ml⁻¹ IGFBP–2⁷). For chemical stimulation, washed cells were incubated with 10 ng ml⁻¹ PMA (Sigma–Aldrich) in DMEM supplemented with 10% FBS as described elsewhere ¹⁶,¹⁷. For cytokine stimulation of HPCs, washed cells were cultured with 100 ng ml⁻¹ rhGM–CSF (R&D systems) and 2.5 ng ml⁻¹ TNF–α (Biolegend).

Methylcellulose colony forming assays were conducted according to the manufacturer’s recommendation (Methocult H4034, StemCell Technologies).

HIV preparation

Infectious supernatants were prepared by transfection of 293T cells using polyethylenimine ¹⁷. For pseudotyped and internal promoter viruses, supernatants were concentrated using high–molecular weight polyethylene glycol (PEG) precipitation ¹⁸. Pellets were resuspended in StemSpan medium and MOIs were calculated using MOI = −Ln(1−p) where p is the proportion of CEM T cells infected. HIV infections were conducted using a standard spin infection technique for primary cells.

Flow cytometry

Cells were stained in FACS buffer (2% FBS, 1% human serum, 2 mM HEPES, 0.025% NaN₃ and PBS) for 20 min on ice, washed and fixed in 2% paraformaldehyde and PBS. For intracellular Gag staining, cells were then incubated for 5 min in 0.1% Triton–X100 in PBS at room temperature. Washed cells were incubated with antibody to Gag in FACS buffer for 30 min on ice and analyzed on a FACScan or FACSCanto flow cytometer. Cell sorting was performed using a FACSVantage SE in Normal–R mode with a sorted drop envelope of 1.0.

qPCR integration assay

Genomic DNA was isolated with Qiagen DNeasy Blood and Tissue Kit. Assays were similar to those previously described [25]. One primer was modified to utilize a more conserved sequence (2^nd–LTR–F–univ, GTGTIGAAAATCTCTAGCAGTGGC). Copy number per sample was calculated using a standard curve based on ACH–2 cell DNA ¹⁹.

Isolation of CD34⁺ cells from HIV–infected donors

HIV⁺ individuals were recruited from The University of Michigan HIV–AIDS Clinic and informed consent was obtained according to a Univeristy of Michigan IRB–approved protocol. 10 ml of marrow was obtained in preservative–free heparin. CD34⁺ cells were isolated as described above.

1