pubmed.ncbi.nlm.nih.gov

Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer - PubMed

  • ️Invalid Date

Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer

Juan Jovel et al. J Virol. 2007 Nov.

Abstract

Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

PubMed Disclaimer

Figures

FIG. 1.
FIG. 1.

Characterization of the recovery phenotype in N. benthamiana plants infected with ToRSV. (a to c) Symptom development in ToRSV-infected plants. ToRSV-induced symptoms in inoculated (a) and first systemic (b) leaves are followed by the emergence of recovered leaves (c). (d and e) Colocalization of hydrogen peroxide production and necrotic symptoms. Symptomatic leaves were stained with DAB and photographed before (d) and after (e) staining. (f to j) Colocalization of cell wall collapse and necrotic symptoms. Symptomatic leaves were stained with trypan blue and photographed before (f) and after (g) staining. Close-up examinations of trypan blue-stained healthy tissues (h) and ToRSV-infected tissues [two adjacent necrotic rings separated by a nonnecrotic region (i) and a necrotic vein (j)] are shown. (k) Transcriptional activation of PR1a in ToRSV-infected tissues. For each sampling date, the inoculated leaf (lanes 1, 4, and 7), the first systemically infected leaf (lanes 2, 5, and 8), and the apical leaf (lanes 3, 6, and 9) were included. PR1a transcripts were detected by Northern blotting using a full-length N. benthamiana PR1a cDNA probe. Lane M, mock-inoculated plant. (l and m) Accumulation of starch grains in ToRSV-infected cells. Cells from mock-inoculated (l) or ToRSV-infected (m) plants were stained with uranyl acetate and analyzed by electron microcopy. Arrowheads indicate the locations of starch grains. (n to q) Impairment of starch translocation in ToRSV-infected plants. Accumulation of starch was revealed by JJK staining of ToRSV-infected or mock-inoculated plants at 14 or 45 dpi, as indicated. Lower insets are close-up magnifications of leaf sections from plants shown in panels n and o. The arrow in panel p points to a leaf that was initially symptomatic.

FIG. 2.
FIG. 2.

High steady-state levels of ToRSV RNA are found in time course experiments conducted on several plant species. (a) Time course analysis of ToRSV RNA concentration in infected N. benthamiana plants. Leaves from three individual plants were analyzed for each time point. Lane M, mock-inoculated plants; lanes i, inoculated leaf; lanes 3, third leaf from the top; lanes 1, apical leaf. (b) Detection of negative- and positive-strand ToRSV RNA in symptomatic (5 dpi) or recovered (30 dpi) leaves. (c and d) Time course analyses of viral RNA levels in N. clevelandii (c) and cucumber (d) plants. Fragments of ToRSV RNA corresponding to the CP and MP open reading frames (amplified with primers p47F [5′-GTCCCATGGGGTCTTCTCTAGGAACTCCTGGT] and p51R [5′-GTCCTCCAGGCCACGCCCGAAAGGAT]) were used for hybridization of blots in panels a, c, and d. The strand-specific probes used for panel b consisted of a 139-nt fragment from the 3′-nontranslatable region of ToRSV (67), which is identical in RNA 1 and RNA 2. Sense and antisense radiolabeled transcripts were generated in vitro using the T7 and SP6 polymerases and the cDNA fragment inserted between the corresponding promoters. Because the probes were produced using different polymerases, the ratio of positive- to negative-strand RNA could not be inferred directly.

FIG. 3.
FIG. 3.

ToRSV accumulation is not affected by Medicago truncatula RDR1 or N. benthamiana RDR6 activity. (a) Symptoms induced by ToRSV on N. benthamiana plants expressing MtRDR1 or on plants transformed with an empty vector. (b) Concentration of ToRSV RNA in MtRDR1 or control (vector) plants, as determined by Northern blotting (top). Transcription of MtRDR1 was confirmed by reverse transcription-PCR, using primers mtPm5 and mtPm3 (72) (bottom). (c and d) ToRSV-induced symptoms in RdR6i or wild-type (WT) N. benthamiana plants grown at 21 or 27°C. (e) Northern blot of ToRSV RNA in RDR6i and wild-type plants cultivated at 21 or 27°C. ToRSV-specific probes for hybridization were prepared as described in the legend to Fig. 2. In every case, the topmost leaf was sampled at 14 dpi.

FIG. 4.
FIG. 4.

Characterization of ToRSV-derived siRNAs. (a) Detection of ToRSV-derived siRNAs in N. benthamiana and N. clevelandii plants. Thirty- and 45-μg samples of low-molecular-weight RNA from ToRSV-infected N. clevelandii (lanes 1 to 3) and N. benthamiana (lanes 4 to 6) plants, respectively, were analyzed. Lane M, equivalent amounts of low-molecular-weight RNA extracted from mock-inoculated plants. ToRSV-specific probes for hybridization were prepared as described in the legend to Fig. 2. The position of a 20-nt oligonucleotide used as a size marker is indicated to the left of the gel. (b) Comparison of viral siRNA concentrations in plants infected with ToRSV and with PVX. Eight micrograms of low-molecular-weight RNA was loaded into each well. As a loading control, 1/10 of each sample was run in a 1% agarose gel and stained with EtBr. For hybridization, labeled 1,000-nt cDNA fragments corresponding to nt 1001-2000 of the PVX or ToRSV genome were used as probes. The following primers were used for amplification: for PVX, p117F (5′- CGATTCTTAAGAAAACTATG) and p118R (5′-TCCCTCTGAATCTCCAGCGC); and for ToRSV, p122F (5′-TGTTGTCGCCCCCCTTGCC) and p123R (5′-CACTAGCCCATCGCCAATAG). An equal amount of labeled probe (0.15 × 109 cpm/μg) was added to each membrane. Membranes were processed in parallel, and hybridization signals were collected simultaneously using a single phosphorimage screen. (c) Mapping of siRNAs along the ToRSV genome. Amplified fragments of approximately 1,000 nt covering the entire RNA 1 and RNA 2 are depicted in the diagram. Each fragment (140 ng) was run in a 1% agarose gel. As a negative control, 1 μg of a fragment containing PNRSV MP was loaded in the rightmost lane. Fragments 8 and 15 correspond to the 3′-untranslated region, which is identical in ToRSV RNA 1 and RNA 2 (lane 8). Hybridization was conducted as described in Materials and Methods. EtBr staining of PCR-generated fragments is shown as a loading control.

FIG. 5.
FIG. 5.

ToRSV does not prevent assembly and/or affect the activity of RISCs. (a) Design of sensor constructs. Fragments (81 nt long) from PNRSV RNA 3 or ToRSV RNA 1 were fused in frame to the 3′ end of the GFP coding sequence and expressed under the control of the 35S promoter. The putative secondary structures of the fragments (as predicted by the Mfold program) are shown. (b) Relative fluorescence obtained after expression of sensor constructs in mock-inoculated or ToRSV-recovered leaves 5 days after agroinfiltration. (c) Comparative analysis of the concentrations of GFP (top), GFP mRNA (middle), and ToRSV RNA (bottom) in mock-inoculated or ToRSV-recovered plants 5 days after agroinfiltration. For detection of GFP mRNA and ToRSV RNA, a full-length GFP cDNA (amplified with primers p18F [5′-ATGAGTAAAGGAGAAGAACT] and p19R [5′-CAAACTCAAGAAGGACCATG]) and the ToRSV CP open reading frame (amplified with primers p52F [5′-GTCTCTAGATGGGGCGGGTCCTGGCAAGAAGG] and p51R [described in the legend to Fig. 2]) were used as probes, respectively. For relative quantification of band intensities, digital light units were measured from each lane from both EtBr-stained gel pictures and phosphorimages from Northern blots, using OptiQuant 5.0 software (Perkin-Elmer). The relative RNA concentration was corrected using the following formula: values from the blots (intensities of RNA signals)/values from the EtBr-stained gel pictures (amounts of RNA loaded). The results were divided by the maximum value so that the relative concentrations of RNA are presented on a scale of 0 to 1 (shown above each lane of the GFP mRNA and ToRSV RNA Northern blots).

FIG. 6.
FIG. 6.

ToRSV does not prevent the establishment or maintenance of silencing of a GFP transgene but partially hinders systemic movement of the silencing signal. (a) Inability of ToRSV to revert fully established silencing of a GFP transgene. Silencing of the GFP transgene was induced in N. benthamiana 16c plants by agroinfiltration of a sense GFP transgene (a1). Systemically silenced GFP plants were challenged by inoculation with ToRSV or PVY (a2). Three to four weeks after inoculation, PVY-infected plants displayed green fluorescence (a3), while ToRSV-inoculated plants remained red (a4). PTGS, posttranscriptional gene silencing. (b) Delay of systemic silencing of the GFP transgene in ToRSV-infected plants. Silencing of GFP in 16c plants was induced as described for panel a1, and plants were inoculated with ToRSV or PVY when systemic leaves exhibited red veins under UV light, indicating that silencing was progressing into mesophyll cells (b1). By 35 dpi, all PVY-inoculated plants had completely green fluorescent leaves in the apical zone (b2), while all mock-inoculated plants had turned completely red (not shown). At 35 dpi, a subpopulation of ToRSV-infected plants showed various degrees of green fluorescence (b3), but it vanished a few days later (b4). (c) Partial inhibition of systemic silencing of GFP triggered in ToRSV-infected symptomatic leaves. Silencing of GFP was induced in leaves showing the initial symptoms associated with ToRSV infection (c1). Systemic silencing was assumed to have occurred when red veins were observed in systemic leaves under UV light (c2). Plants that did not show any red fluorescent veins in systemic leaves (c3) were counted as nonsilenced plants. (c4) According to this criterion, the systemic occurrence of silencing was evaluated in 36 ToRSV- or mock-inoculated plants at the intervals indicated.

FIG. 7.
FIG. 7.

Evaluation of GFP and ToRSV concentrations in ToRSV-infected plants at various times after induction of GFP silencing. (a) Analysis of GFP mRNA and siRNAs in a subpopulation of ToRSV-infected plants in which silencing of GFP was hindered in systemic leaves. Plants (16c line) were first mock inoculated or inoculated with ToRSV or PVY. Silencing of the GFP transgene was induced after initial development of virus-induced symptoms as described in the legend to Fig. 6c. Plants were tested for the presence of GFP mRNA and siRNA in the agroinfiltrated (i) and systemic (s) leaves at 18 days postagroinfiltration. RNAs from GFP transgenic plants that had not been silenced (lane 7) and from wild-type plants (lane 8) were used as controls. (b) Accumulation of ToRSV in a subpopulation of ToRSV-infected plants in which systemic silencing of GFP was active. Concentrations of GFP protein, GPF mRNA, and GFP-derived siRNAs (lanes 1 to 3) and of ToRSV CP, ToRSV RNA, and ToRSV-derived siRNAs (lanes 6 to 8) were analyzed in three individual plants at 120 dpi. Mock-inoculated silenced (lane 5) or nonsilenced (lane 4) plants were used as controls for the analysis of GFP protein and RNAs. Mock-inoculated (lane 9) or ToRSV-infected (7 dpi) (lane 10) plants were included as controls for the analysis of ToRSV CP and RNAs. Detection of GFP mRNA and ToRSV RNA was done as described in the legend to Fig. 5. Five- and 50-μg samples of total RNA were used for Northern blotting and siRNA detection, respectively. (c) Accumulation of ToRSV in GFP-silenced or -nonsilenced branches late in infection. At 120 dpi, levels of GFP protein and ToRSV CP in red fluorescent (silenced) or green fluorescent (nonsilenced) branches of ToRSV-infected 16c plants were tested by Western blotting.

Similar articles

Cited by

References

    1. Ahlquist, P. 2006. Parallels among positive-strand RNA viruses, reverse-transcribing viruses and double-stranded RNA viruses. Nat. Rev. Microbiol. 4:371-382. - PMC - PubMed
    1. Akbergenov, R., A. Si-Ammour, T. Blevins, I. Amin, C. Kutter, H. Vanderschuren, P. Zhang, W. Gruissem, F. Meins, Jr., T. Hohn, and M. M. Pooggin. 2006. Molecular characterization of geminivirus-derived small RNAs in different plant species. Nucleic Acids Res. 34:462-471. - PMC - PubMed
    1. Alamillo, J. M., P. Saenz, and J. A. Garcia. 2006. Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco. Plant J. 48:217-227. - PubMed
    1. Anandalakshmi, R., G. J. Pruss, X. Ge, R. Marathe, A. C. Mallory, T. H. Smith, and V. B. Vance. 1998. A viral suppressor of gene silencing in plants. Proc. Natl. Acad. Sci. USA 95:13079-13084. - PMC - PubMed
    1. Axtell, M. J., C. Jan, R. Rajagopalan, and D. P. Bartel. 2006. A two-hit trigger for siRNA biogenesis in plants. Cell 127:565-577. - PubMed

Publication types

MeSH terms

Substances

LinkOut - more resources