Distinct Modes of Inhibition by Sclerostin on Bone Morphogenetic Protein and Wnt Signaling Pathways

Cells

SAOS-2 human osteosarcoma cells, HEK293 and HEK293T cells, and C2C12 cells stably transfected with the BRE-luciferase (BRE-luc) reporter (30) were cultured in 4.5 g/liter glucose Dulbecco's modified Eagle's medium (Invitrogen). Saos-2 cell lines were lentivirally transduced in order to express either a non-targeting control shRNA (shRNA control, CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT; Sigma) or shRNA targeting SOST (shRNA 1, CCGGCCACAACCAGTCGGAGCTAACTCGAGTTGAGCTCCGACTGGTTGTGGTTTTTG; shRNA 2, CCGGGCTGGAGAACAACAAGACCATCTCGAGATGGTCTTGTTGTTCTCCAGCTTTTTG; Sigma), followed by puromycin selection (5 μg/ml) to obtain SOST-knockdown Saos-2 cells. Mouse mesenchymal KS483 cells were cultured in α-minimum essential medium (Invitrogen) (31). All media were supplemented with 10% fetal bovine serum (Integro) 100 IU/ml penicillin and 100 IU/ml streptomycin (Invitrogen).

Expression Plasmids

The expression construct pcDNA3-hBMP7 and the pGEM3Zf-mWnt3a expression construct have been described previously (32). C-terminally 3× HA-tagged human BMP7 pro-peptide-expressing construct was generated using a PCR approach. Primers 5′-ATTGGTACCTAGAGCCGGCGCGATGCACG-3′ (5′, containing the ATG codon and KpnI restriction site) and 5′-GCCAAGCTTATGCTGCGGAAGTGGACCTC-3′ (3′, containing the HindIII restriction site) were used to amplify a fragment of hBMP7 cDNA that contains the signal peptide and a pro-peptide part. The purified PCR fragment was cloned in frame 5′ of the 3× HA-encoding sequence in 3× HA-pBlueScript vector. The pcDNA3-mLRP5-N-MycΔ expression construct was kindly provided by Xi He (Children's Hospital, Harvard) (22), and pcDNA3-hLRP5 (WT-LRP5) was from Wendy Balemans (University of Antwerp, Belgium). The pcDNA3-hSOST as well as the pST-hSOST-N-FLAG construct were kindly provided by Brian Kovacevich (Renton, WA). The BMP- and TGF-β-responsive luciferase reporter constructs (BRE-luc and CAGA₁₂-luc, respectively) as well as the Wnt-responsive luciferase reporter construct (BAT-luc) have been described previously (33, 34). The expression constructs for Smad1 wild type (WT) as well as the Smad mutant (GM) deficient in phosphorylation of the linker region through GSK3β were kindly provided by Edward De Robertis (Howard Hughes Medical Institute, Los Angeles, CA) (35). Dominant negative TCF4 (pcDNA-TCF4d/n) and constitutively active β-catenin mutant S33Y were generously provided by Hans Clevers (Hubrecht Laboratory, The Netherlands). Preparation of Myc-His-ubiquitin has been described previously (36).

Reagents and Recombinant Proteins

Recombinant human BMP7 was kindly provided by K. Sampath (Creative Biomolecules, Inc., Hopkinton, MA). Recombinant mouse Wnt-3a and Dkk-1 were purchased from R&D Systems. Recombinant mouse and human sclerostin were prepared as described previously (37). For BIAcore measurements, rec.BMP7 was obtained from Wyeth, LRP6 was purchased from R&D Systems, the extracellular domain of IL-4R was obtained from Walter Sebald (Biocenter, University Wuerzburg), and the control Fab fragment AbD09095 was obtained from AbD (Morphosys Inc.). MG132 was purchased from Calbiochem.

RNA Isolation and Quantitative Real-time PCR

Total RNA was isolated using the RNeasy kit (Macherery-Nagel) according to the manufacturer's instructions. RT-PCR was performed using the RevertAid^TM H Minus First Strand cDNA synthesis kit (Fermentas) according to the manufacturer's instructions. Expression of human SOST, BMP7, and GAPDH were analyzed using the following primers: SOST, 5′-GAGCAGCCATCACAAACTCA-3′ and 5′-CAAGTCCCACGTGGAAGAAT-3′; BMP7, 5′-CCACCTGTAATCCCAGCACT-3′ and 5′-GACAAAGACCAGAGGGTCCA-3′; GAPDH, 5′-ATCACTGCCACCCAGAAGAC-3′ and 5′-ATGAGGTCCACCACCCTGTT-3′. All conditions were measured in duplicate, and Taqman PCRs were performed using the StepOne Plus^TM real-time PCR system (Applied Biosystems). Gene transcription levels were determined with the comparative ΔΔCt method using GAPDH as a reference, and the non-stimulated condition was set to 1.

Luciferase Reporter Assays

Cells were transiently transfected using FuGENE 6 (Roche Applied Science) transfection reagent, with 0.1 μg of firefly luciferase reporter construct, 0.1 μg of β-galactosidase, together with the indicated expression plasmids or empty control plasmid (pcDNA3.1), according to the manufacturer's instructions. Cells were allowed to recover for 18 h, followed by serum starvation and stimulation with the indicated ligands for 18 h. Afterward, conditioned medium (CM) was collected, and cells were washed with PBS and lysed. C2C12-BRE-luc cells were stimulated with CM for 18 h and lysed. Luciferase assays were performed using the luciferase reporter assay system (Promega) according to the manufacturer's instructions using β-galactosidase activity as an internal control. Each transfection was carried out in triplicate, and representative experiments are shown.

Co-immunoprecipitation, Ubiquitination, and Western Blot Analysis

Cells were transfected with respective expression constructs or empty control plasmid (pcDNA3.1) using the calcium phosphate precipitation method. The following day, the cells were stimulated with the indicated ligands for 18 h and lysed. For Western blot, ubiquitination, and co-immunoprecipitation analysis, cells were allowed to grow to 70% confluence, and serum concentration was reduced to 0.5% overnight. For co-immunoprecipitation, cells were lysed in ice-cold lysis buffer (50 mm Tris-HCl (pH 7.5), 100 mm NaCl, 0.2% Tween 20, and 1 protease inhibitor mixture tablet (Roche Applied Science) per 50 ml). Cell lysates (400 μg of total protein) or CM (50 ml) were incubated with 1 μg/μl anti-FLAG M2 (Sigma) or anti-c-Myc (9E10) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) antibody for 1.5 h at 4 °C. 0.5 μg/μl protein A-Sepharose beads (Amersham Biosciences) was added and incubated for an additional 1.5 h at 4 °C. Beads were extensively washed with ice-cold lysis buffer containing 500 mm NaCl, and eluted protein complexes were subjected to SDS-PAGE and Western blot analysis. Western blot analyses were performed as described previously (38). C-terminal Smad phosphorylation was detected using an antibody specifically recognizing phosphorylated Smad1/5/8 (P-Smad1), which has been described previously (39). The linker phosphorylation of Smads through GSK3β or MAPK signaling was investigated through the use of P-Smad^GSK3 and P-Smad^MAPK antibodies obtained from the DeRobertis laboratory (35). BMP7 expression was investigated with a BMP7 antibody kindly provided by Hicham Alaoui (Stryker Biotech, Hopkinton, MA). SOST-N-FLAG expression and LRP5-N-Myc expression were detected using anti-FLAG M2 (Sigma) and anti-c-Myc (9E10) (Santa Cruz Biotechnology, Inc.), respectively. Pro-BMP7-HA and pro-TGF-β-HA were detected via an anti-HA (12CA5) antibody (Roche Applied Science). Ubiquitination assays were performed as described previously (40). The Myc-His-ubiquitin was detected through a clone HIS-1 antibody (Sigma). Equal loading was confirmed using an anti-β-actin antibody (Sigma) or anti-Smad1 antibody (Zymed Laboratories Inc.). Secondary horseradish peroxidase-conjugated goat anti-rabbit and sheep anti-mouse IgG antibodies (Amersham Biosciences) were used for detection using ECL (Amersham Biosciences). Quantitative Western blotting was performed using secondary goat anti-rabbit IRDye 680 and goat anti-mouse IRDye 800CW (LI-COR) using the Odyssey Scanner according to the manufacturer's instructions.

Alkaline Phosphatase Activity Assay

KS483 cells were seeded in 96-well plates and grown until confluent. Cells were stimulated with the indicated ligands in 0.2% FBS-containing α-MEM. Alkaline phosphatase activity was measured kinetically after another 4 days of culture. Measurements were corrected for protein content using the DC protein assay (Bio-Rad).

Immunofluorescence

For immunofluorescence staining, KS483 cells were grown on coverslips overnight and stimulated the next day for 3 h with the indicated ligands. Cells were fixed with 4% paraformaldehyde, washed twice with PBS, quenched with 20 mm NH₄Cl, and permeabilized with 0.1% Triton X-100. Afterward, cells were incubated in blocking solution (PBS containing 3% bovine serum albumin) for 45 min, followed by incubation with anti-β-catenin antibody (BD Transduction Laboratories) suitably diluted in blocking solution for 1 h. After washing, labeled secondary antibodies AlexaFluor 488 and goat anti-mouse IgG (Invitrogen) were used for detection. Nuclei were stained using Hoechst 33258 (Invitrogen) according to the manufacturer's instructions. Specimens were visualized with an Olympus IX51 microscope at ×100 magnification using the cell^F Soft Imaging System (Olympus).

Sclerostin Knock-out Mice

A knock-out allele of Sost was generated via KOMP (line VG10069). The entire protein-coding sequence of Sost was replaced with LacZ and a floxed Neo cassette, in a manner such that the initiating ATG of Sost became the initiating methionine of LacZ. All of the details regarding the generation of this allele can be found at the Velocigene Web site. SostLacZ/+ mice were generated using clone VG10069A-G10 (supplemental Fig. S1). This allele has been tested, and it phenocopies other published knock-out lines of Sost (supplemental Fig. S2).

Immunohistochemistry, Alcian Blue, and TUNEL Assay

Dissected bone tissues from 4-month-old female sclerostin KO mice or wild type mice were fixed overnight in 10% paraformaldehyde, pH 6.8, at 4 °C; decalcified using 10% EDTA, pH 7.4; and processed for paraffin embedding and sectioning. Before blocking endogenous peroxidase activity with 40% methanol, 1% H₂O₂ in PBS, sections were deparaffinized and rehydrated using xylene and a descending alcohol series. Antigen retrieval using Proteinase K (2.5 μl in 100 mm Tris, pH 9.0, and 50 mm EDTA, pH 8.0) for 10 min at 37 °C was followed by three washes with 0.1 m Tris-buffered saline (pH 7.4) containing 0.02% Tween 20 (TNT). Thereafter, slides were incubated with 5% species-specific serum (Dako) in 0.5% Boehringer blocking reagent (Roche Applied Science) in TNT for 60 min at 37 °C. Subsequently, the following antibodies diluted in 0.5% Boehringer milk powder/TNT were applied overnight at 4 °C: rabbit anti-BMP7 antibody (1:100) (Stryker), mouse anti-β-catenin antibody (1:100) (BD Transduction Laboratories), rabbit anti-PS1 antibody directed against C-terminal phosphorylated Smad1/5/8 (1:50) (39), and goat anti-sclerostin antibody (1:400) (R&D Systems). A species-specific biotinylated anti-IgG antibody (1:300 diluted in 0.5% Boehringer milk powder/TNT) followed for 45 min at 37 °C. Incubation with streptavidin horseradish peroxidase (1:200 in 0.5% Boehringer milk powder/TNT) for 30 min at 37 °C preceded and followed an amplification step using biotinylated tyramine. Stainings were carried out using amino-9-ethyl-carbazole (Sigma) and Mayer's hematoxylin (Merck) according to the manufacturer's instructions. A water-based mounting solution was applied, and stainings were visualized with an Olympus IX51 microscope using the cell^F Soft Imaging System (Olympus).

To discriminate cartilage from bone, Alcian blue staining was performed. Histology sections were incubated in 1% Alcian blue 8GX (pH 2.5) in 3% acetic acid (Merck) for 15 min before rinsing the slides with distilled water. Counterstaining with toluylene red (Merck) was performed for 1 min according to the manufacturer's instructions.

To detect apoptosis, a Dead End Colorimetric TUNEL system (Promega) was used according to the manufacturer's instructions. The total positive osteocytes in the indicated areas were counted manually, and the percentage of apoptotic cells was calculated.

In Vitro Interaction Analysis Using Surface Plasmon Resonance

LRP6, BMP7, IL-4R, and AbD09095 proteins were biotinylated using NHS-LC-Biotin (Pierce) according the manufacturer's recommendation. To minimize inactivation due to multiple biotinylation, the molar stoichiometry of protein to NHS-LC-Biotin was kept at 1:1. The surface of a BIAcore CM5 biosensor was first activated via NHS/EDC, and streptavidin was subsequently coupled to the activated surface to a final density of ∼3000 resonance units. Biotinylated proteins were then immobilized to a surface density of 200 (BMP7) to 550 resonance units (LRP6). Due to the high positive charge of sclerostin, we used IL-4R, which is highly negatively charged, and the anti-sclerostin Fab antibody AbD09095 to establish experimental conditions that show no nonspecific binding of sclerostin (used as analyte) to the biosensor surface. Different running buffer conditions with varying salt concentrations were tested, showing that upon the addition of 300 mm NaCl no interaction with the charge-complementary IL-4R is observed, and at the same time, binding to the anti-sclerostin antibody AbD09095 is unaltered. Interaction of sclerostin and variants with BMP7 and LRP6 was then measured by perfusing the biosensor using six different concentrations for each analyte. All experiments were performed using HBS300 buffer (10 mm HEPES, pH 7.5, 300 mm NaCl, 0.005% surfactant P20) as running buffer. The association phase was monitored by injecting the analyte for 300 s at a flow rate of 10 μl/min. The dissociation phase was initiated by perfusing only HBS300 buffer and monitored for 200 s. The biosensor surface was regenerated by perfusing a short (60-s) pulse of buffer containing 6 m urea, 1 m sodium chloride, 0.1 m acetic acid. Sensorgrams were evaluated using the software BIAevaluation version 2.4. Due to the fast association and dissociation kinetics, binding coefficients were deduced from the dose dependence of equilibrium binding.

Statistical Analysis

Values are expressed as mean ± S.D. For statistical comparison of two samples, an unpaired two-tailed Student's t test was used to determine the significance of differences between means. All relevant comparisons were considered to be significantly different (*, p < 0.05; **, p < 0.01; ***, p < 0.001). Experiments were performed at least three times, and representative results are shown.

Sclerostin Inhibits Wnt Signaling

Previously, we reported that sclerostin antagonizes BMP-stimulated bone formation, not by direct inhibitory effects on exogenous BMPs but by targeting the Wnt pathway. Sclerostin was found to share many characteristics with the Wnt antagonist dickkopf-1 (Dkk1) in antagonizing BMP-stimulated osteoblast differentiation and direct Wnt-induced responses (32). Results from others had indicated that sclerostin (and its close homolog Sostdc1) may target BMP signaling directly by sequestering BMPs and thereby preventing receptor binding (9, 15). Some of these experiments were performed not by stimulating cells with exogenous ligands but instead by transfecting expression plasmids or by mRNA injections (32, 41). This made us revisit the interplay between sclerostin with Wnt and BMP. First, we confirmed that sclerostin has an antagonistic effect on BMP- or Wnt-induced osteoblast differentiation. We stimulated KS483 osteoprogenitor cells with either recombinant BMP7 or recombinant Wnt3a in the presence or absence of recombinant sclerostin. Sclerostin inhibited the BMP7- and Wnt3a-induced activity of the early marker for osteoblast differentiation alkaline phosphatase (ALP) in a dose-dependent manner (Fig. 1A). Sclerostin has been shown to inhibit canonical Wnt signaling by binding to the LRP5 and LRP6 co-receptors (21, 22). To confirm the association of sclerostin with LRP5, we co-transfected SOST and LRP5 in HEK293T cells and performed co-immunoprecipitation experiments. Indeed, sclerostin co-immunoprecipitated with LRP5, and vice versa (Fig. 1B). Surprisingly, binding to the sclerostin receptor LRP6, as measured through surface plasmon resonance (BIAcore), revealed a rather low binding affinity with K_D(eq) values ranging from 2 to 8.6 μm for full-length murine and human sclerostin, respectively (supplemental Fig. S3A and Table 1). Moreover, we investigated by immunofluorescence the effect of sclerostin on Wnt-induced changes in subcellular localization of β-catenin in KS483 cells. Upon stimulation with recombinant Wnt3a, β-catenin translocated to the nucleus, which was completely blocked by Dkk1 and attenuated in ∼60% of the cells by sclerostin (Fig. 1C and supplemental Fig. S3B). Co-transfection of a Wnt3a expression plasmid in HEK293T cells resulted in a 3-fold activation of the Wnt reporter construct BAT-luciferase (Fig. 1D). As expected, sclerostin antagonized this Wnt3a-induced reporter activity. Interestingly, co-expression of sclerostin and LRP5 did not reduce but significantly increased Wnt reporter activity. When Wnt3a, LRP5, and SOST were co-expressed, a reduction of the Wnt-induced reporter activity was achieved compared with LRP5/sclerostin co-expression (Fig. 1D). Consistent with previous reports (21, 22, 32), we show that sclerostin inhibits Wnt/LRP5 signaling.

Sclerostin Inhibits BMP Signaling

Previous studies had shown that sclerostin could bind BMPs but that the affinity is rather low. To investigate binding of sclerostin to BMP7, we performed immunoprecipitation experiments on HEK293T cells co-transfected with BMP7 and SOST expression plasmids. BMP7 and sclerostin were found to interact in CM of these cells (Fig. 2A). Notably, a decrease in BMP7 expression was detectable in the presence of sclerostin compared with when BMP7 was expressed alone. However, when expressed separately and immunoprecipitation was performed on mixed CM, no binding of sclerostin to BMP7 could be detected (data not shown). Binding of sclerostin to BMP7 as investigated through BIAcore measurements revealed similar low affinity of sclerostin to BMP7 as to LRP6, with K_D(eq) values ranging from 1 to 3.8 μm for full-length murine and human sclerostin, respectively (supplemental Fig. S3A and Table 1).

In line with this low affinity interaction and consistent with previous results, we showed that sclerostin does not inhibit direct exogenous BMP-induced Smad-mediated responses; recombinant BMP7-induced C-terminal Smad1/5/8 phosphorylation and Smad1/Smad4-driven BRE-luc transcriptional response were not affected by recombinant sclerostin (Fig. 2, B and C, lanes 1–7) or transfected SOST expression plasmid (data not shown) (32). Interestingly, however, we observed that when SOST and BMP7 are co-transfected, sclerostin can dose-dependently inhibit BMP7/Smad-induced signaling responses (Fig. 2, B and C, lanes 8–14).

These results together with the inhibition of BMP7 secretion by sclerostin (Fig. 2B) suggested that sclerostin might retain BMP7 intracellularly when co-expressed. Therefore, we investigated whether the pro-domain of BMP7 plays a role in the interaction with sclerostin. We first noted that the pro-domain of BMP7 (lacking the mature domain) is secreted when expressed alone, whereas co-expression with sclerostin eliminated the observed secretion of the BMP7 pro-domain (Fig. 2D).

When co-expressed, binding of sclerostin to the isolated pro-domain of BMP7 was observed in the cell lysates (Fig. 2, D and E). To rule out nonspecific binding of sclerostin to BMPs, we simultaneously performed the co-immunoprecipitations with pro-TGFβ1. No sequestration of TGF-β prodomain (data not shown) or binding with sclerostin was detectable (Fig. 2E).

Reduced SOST Expression Leads to Elevated BMP Signaling

Because we found that sclerostin can inhibit BMP signaling when BMPs and SOST were co-transfected, we wondered whether the investigated effects are truly sclerostin-dependent. We therefore studied the effects of shRNA-mediated SOST knockdown in the human osteogenic sarcoma cell line Saos-2, which displays endogenous SOST expression (42). Upon BMP7 stimulation, SOST mRNA levels in Saos-2 cells expressing a non-targeting shRNA were significantly induced (Fig. 3A, lanes 2 and 3). In cells expressing one of two independent SOST-targeting shRNAs, the SOST mRNA expression remained at basal levels during BMP7 stimulation (Fig. 3A, lanes 4–9), whereas mRNA expression of BMP7 remained unaffected (data not shown). Notably, in the background of the SOST-targeting shRNAs, BMP7-induced Smad1/5/8 phosphorylation and BRE-luc activity were significantly increased in the case of BMP7 overexpression compared with control shRNAs (Fig. 3, B and C, respectively). The inductive properties of recombinant BMP7 were also marginally elevated upon SOST knockdown (Fig. 3, B and C), which can be due to the self-induction of BMP expression (data not shown). Similar results were obtained using SOST-targeting siRNAs in HEK293T and MG63 cell lines (data not shown). No effects of SOST-targeting shRNAs were detected on TGFβ1-induced CAGA₁₂ luciferase transcriptional reporter activity (supplemental Fig. S4). Altogether, these findings suggest that sclerostin is directly involved in the regulation of autocrine BMP-induced responses.

Sclerostin Sequesters BMP7 and Mediates Proteasomal Degradation of Intracellular BMP7

To investigate the underlying mechanism of sclerostin-mediated inhibition of BMP signaling, we co-transfected BMP7 and SOST into Saos-2 cells expressing non-targeting or SOST-targeting shRNA. The harvested CM was applied on C2C12 cells stably transfected with the BRE-luciferase reporter (C2C12-BRE-luc), and luciferase activity was determined after 1 day of incubation. This revealed that CM derived from BMP7-transfected cells induced BRE-luciferase activity, whereas BRE activity was dose-dependently reduced when CM derived from BMP7- and SOST-co-transfected cells was added (Fig. 4A). This effect was not observed after incubation with CM of SOST shRNA-expressing cells, suggesting that sclerostin sequestered intracellular BMP7. Therefore, we explored whether in Saos-2 cells, a relation between BMP7 protein levels and sclerostin expression existed. Notably, BMP7 protein levels were reduced in the cell lysates and CM of cells expressing sclerostin (Fig. 4B). This effect was reversed when the cells were incubated with the proteasomal inhibitor MG132 (Fig. 4B). Furthermore, enhanced ubiquitination of pro-BMP7 was detected in the presence of co-transfected SOST in HEK293 cells (Fig. 4C), indicating that sclerostin mediates proteasomal degradation of intracellular BMP7. No alteration of ubiquitination could be observed when sclerostin and pro-TGFβ1 where co-transfected (data not shown). Taken together, we observed that the inhibitory action of sclerostin on BMP7 signaling is due to sequestering and subsequent proteasomal degradation of intracellular BMP7.

Effect of Sclerostin on BMP Signaling Is Independent of Wnt Signaling

Thus far, the inhibitory role of sclerostin on BMP actions has been commonly thought to be indirect through the Wnt signaling pathway (13, 32). Our finding that BMP7 overexpression in Saos-2 cells can induce the Wnt luciferase reporter BAT-luc supports this theory (Fig. 5A). Furthermore, we show that the Wnt luciferase reporter activity can be further potentiated through the presence of SOST-targeting shRNAs. That these activations were indeed through indirect potentiating of the Wnt signaling cascade could be shown via inhibition of activation through dominant negative TCF4 (dN-TCF4) (Fig. 5A and supplemental Fig. S5). To demonstrate that our current findings of sclerostin effects on BMP signaling are direct effects and are not the consequence of altered Wnt signaling, we also determined BMP7-induced BRE-luciferase reporter activity in the presence of dominant negative TCF4. BMP7-induced BRE-luciferase reporter activity was significantly elevated in lysates derived from cells expressing SOST-targeting shRNAs but was not affected when dominant negative TCF4 was co-transfected (Fig. 5B). Because it has been shown that Wnt signaling, in particular GSK3β-mediated phosphorylation of the linker region of Smad proteins, leads to their proteasomal degradation (35), we investigated whether sclerostin plays a role in the BMP7-induced linker phosphorylation. KS483 cells overexpressing BMP7 showed markedly increased Smad1/5/8 phosphorylation at the C terminus (P-Smad1^C-term) and at the two Smad1 linker sites that depend on MAPK and GSK3b (Smad1^MAP and Smad1^GSK3, respectively), and phosphorylation at the C terminus and linker sites was reduced in the presence of co-transfected SOST (Fig. 5C). To show that the effects of sclerostin on BMP7 are not mediated through the inhibitory action of sclerostin on the Wnt pathway, we performed a BRE-luciferase assay in the presence of overexpressed Smad1 WT or a Smad1 mutant that is not susceptible to GSK3β phosphorylation (Smad1-GM). Indeed, sclerostin exhibited its BMP7 antagonizing effect in the presence of either the Smad1-WT or the Smad1-GM mutant (Fig. 5D), indicating that the inhibitory action of sclerostin occurs indeed directly at the BMP level.

Elevated Wnt and BMP Signaling in Sclerostin Knock-out Mice

To investigate whether our findings on the inhibitory action of sclerostin on BMP signaling occur in vivo, we examined the hind limbs from 4-month-old female WT and sclerostin knock-out (KO) mice, with focus on osteocytes in tibia and femur as well as the calcaneus. Sclerostin expression in WT mice was predominantly detected in osteocytes of all investigated bone types as well as in calcified cartilage of the patellar surface of the femur. As expected, no sclerostin expression was detected in sclerostin KO mice (Fig. 6, A–C, and supplemental Fig. S6). Wnt signaling, represented through β-catenin expression, was detected in osteoblasts and osteocytes of tibia and femur as well as in the osteocytes of the calcaneus of WT mice. Elevated β-catenin expression was detected in osteocytes of sclerostin KO mice (Fig. 6, A–C, and supplemental Fig. S6). Interestingly, the expression of β-catenin was not detected in the cartilage of the patellar surface of the femur in WT mice, whereas in sclerostin KO mice, several chondrocytes were positive for β-catenin expression (supplemental Fig. S6A). BMP7 expression was detected mainly in osteoblasts and osteocytes of tibia and femur with less expression in the osteocytes of the calcaneus of WT mice. Elevated BMP7 expression was detected in osteocytes of sclerostin KO mice (Fig. 6, A–C, and supplemental Fig. S6). Remarkably, a loss of BMP7 expression was detected in the articular cartilage of the patellar surface of the femur in a sclerostin KO background (supplemental Fig. S6A). Although elevated BMP signaling was detected in osteocytes of sclerostin KO mice, we raised the question whether that coincides with active canonical BMP signaling. Therefore, we determined the expression of phosphorylated Smad1 (P-Smad1) in osteocytes. Although in WT mice, BMP-7 expression was detectable, no active BMP signaling, as investigated with P-Smad-1 expression, was visible in osteocytes of the tibia, femur, and calcaneus (Fig. 6, A–C). In sclerostin KO mice, on the other hand, P-Smad1 expression was detectable and coincided with BMP7 expression in osteocytes in tibia and calcaneus (Fig. 6, A–C) but remained undetectable in the femur (supplemental Fig. S6). Additionally, P-Smad1 expression was detected in articular cartilage at the patellar surface of the femur of WT mice but was not found in sclerostin KO mice, which is in agreement with the absence of BMP7 expression in these cells (supplemental Fig. S6).

To study whether the detected elevated BMP and Wnt signaling in sclerostin KO mice correlated with the proapoptotic effects of sclerostin on bone cells, we performed a TUNEL assay. As described by Lin et al. (43), sclerostin KO mice show significantly fewer apoptotic osteocytes in the cortical bone of the tibia compared with their WT littermates (Fig. 6, A–C) (43).

The most pronounced differences were detected in the calcaneus (perhaps induced by mechanical stress), where a significant elevation of β-catenin, BMP7 expression, and signaling correlates with a significant decrease of apoptotic osteocytes in the sclerostin KO mice (Fig. 6, A–C). From these data, we conclude that the inhibitory action of sclerostin on Wnt signaling occurs potentially, in addition to on osteoblasts, also on osteocytes of the tibia, femur, and calcaneus. There is no link to a particular bone type detectable for the enhanced Wnt signaling upon loss of sclerostin function. However, effects on BMP7 signaling appear to be predominantly found in osteocytes of the calcaneus and the cortical bone of the tibia.

Supplemental Data (.pdf, 102 KB)